Blackwell Science, LtdOxford, UKEMIEnvironmental Microbiology1462-2912Society for Applied Microbiology and Blackwell Publishing Ltd, 20036 2170182Original Article16S

rRNA probes for Archaea thriving in hot habitatsO. Nercessian et al.

Environmental Microbiology (2004) 6(2), 170182

doi:10.1046/j.1462-2920.2004.00560.x

Design of 16S rRNA-targeted oligonucleotide probes for detecting cultured and uncultured archaeal lineages in high-temperature environments
Olivier Nercessian,1 Maria Prokofeva,2 Alexander Lebedinski,2 Stphane LHaridon,1 Craig Cary,3 Daniel Prieur1 and Christian Jeanthon1* 1 UMR 6539, Centre National de la Recherche Scientique and Universit de Bretagne Occidentale, Institut Universitaire Europen de la Mer, Technopole BrestIroise, Place Nicolas Copernic, 29280 Plouzan, France. 2 Institute of Microbiology, Russian Academy of Sciences, Prospect 60 Let Oktyabrya 7/2, 117811, Moscow, Russia. 3 University of Delaware, College of Marine Studies, 700 Pilottown Road, Lewes, DE 19958, USA. Summary In order to facilitate the evaluation of archaeal community diversity and distribution in high-temperature environments, 14 16S rRNA oligonucleotide probes were designed. Adequate hybridization and wash conditions of the probes encompassing most known hyperthermophilic Archaea, members of the orders Thermococcales, Desulfurococcales and Sulfolobales, of the families Methanocaldococcaceae, Pyrodictiaceae and Thermoproteaceae, of the genera Archaeoglobus, Methanopyrus and Ignicoccus, and of the as yet uncultured lineages Korarchaeota, Crenarchaeota marine group I, deep-sea hydrothermal vent euryarchaeotic group 2 (DHVE 2), and deep-sea hydrothermal vent euryarchaeotic group 8 (DHVE 8) were determined by dot-blot hybridization from target and non-target reference organisms and environmental clones. The oligonucleotide probes were also used to evaluate the archaeal community composition in nine deep-sea hydrothermal vent samples. All probes, except those targeting members of Sulfolobales, Thermoproteaceae, Pyrodictiaceae and Korarchaeota, gave positive hybridization signals when hybridized against 16S rDNA amplication products obtained from hydrothermal DNA extracts. The results conReceived 29 August, 2003; revised 4 November, 2003; accepted 4 November, 2003. *For correspondence. E-mail jeanthon@univ-brest.fr; Tel. (+33) 298 498 751; Fax (+33) 298 498 705. Present address: Department of Chemical Engineering, Box 352125, University of Washington, Seattle, WA 98195, USA. E-mail nerceo@u.washington.edu

rmed the widespread occurrence of Thermococcales, Desulfurococcales, Methanocaldococcaceae and Archaeoglobus in deep-sea hydrothermal vents, and extended the known ecological habitats of uncultured lineages. Despite their wide coverage, the probes were unable to resolve the archaeal communities associated with hydrothermally inuenced sediments, suggesting that these samples may contain novel lineages. This suite of oligonucleotide probes may represent an efcient tool for rapid qualitative and quantitative characterization of archaeal communities. Their application would help to provide new insights in the future into the composition, distribution and abundance of Archaea in high-temperature environments. Introduction Analysis of archaeal 16S rRNA sequences has enabled the phylogeny of Archaea to be described and major groups to be identied (Woese et al., 1990; Hugenholtz, 2002). So far composed of 12 recognized orders, 69 genera and more than 210 characterized species, Archaea are divided into two phyla (Garrity and Holt, 2001). The phylum Euryarchaeota consists of extreme halophiles, thermoacidophiles, methanogens, hyperthermophilic sulphate and/or sulphite reducers and sulphur metabolizers. The phylum Crenarchaeota is primarily composed of hyperthermophiles, most of which are able to metabolize sulphur (Garrity and Holt, 2001). With the advent of modern molecular biological techniques, the diversity and widespread distribution of Euryarchaeota and Crenarchaeota in previously unsuspected habitats have been recognized (DeLong, 1992; Bintrim et al., 1997; Vetriani et al., 1999; Takai et al., 2001a). A third archaeal phylum, Korarchaeota, has been postulated on the basis of environmental 16S rRNA sequences retrieved from microbial communities from the Yellowstone Park (Barns et al., 1996). However, as no representatives of this group have been isolated in pure culture, the phylum status of this lineage cannot currently be assessed. Assessment of microbial diversity in diverse hightemperature environments has led to the discovery of metabolically diverse Archaea that are thought to contrib-

2004 Blackwell Publishing Ltd

16S rRNA probes for Archaea thriving in hot habitats 171 ute signicantly to the biogeochemical cycles within these habitats (Takai and Horikoshi, 1999; Orphan et al., 2000; Takai et al., 2001b). The analysis of 16S rRNA genes of hydrothermal vent microbial communities revealed a wide diversity of sequences with no close relatives in culture (Barns et al., 1996; Takai and Horikoshi, 1999; Takai and Sako, 1999; Reysenbach et al., 2000; Huber et al., 2002; Nercessian et al., 2003). Owing to the lack of determinative molecular tools, the qualitative and quantitative determination of archaeal assemblages in high-temperature environments still remains poorly assessed. In this study, we report on the development of a suite of 14 16S rRNAtargeted oligonucleotide probes for different archaeal phylogenetic levels of cultured and uncultured organisms retrieved from deep-sea hydrothermal systems (Takai and Horikoshi, 1999; Takai and Sako, 1999; Reysenbach et al., 2000; Huber et al., 2002; Teske et al., 2002; Nercessian et al., 2003). In the context of a preliminary application, we analysed the composition of archaeal communities associated with diverse deep-sea hydrothermal vent samples. Results and discussion Probe design The design of oligonucleotide probes was based on comparative analysis of 11 143 complete and partial 16 rRNA sequences of the ARB database using the PROBE DESIGN option of the ARB package. In addition to automatic design of probes, alignments of 16S rRNA sequences were screened to nd signatures that allow the distinction of orders, families and genera of cultured archaeal thermophiles as well as currently uncultured lineages of Archaea known to thrive in hydrothermal ecosystems (Takai and Horikoshi, 1999; Takai and Sako, 1999; Reysenbach et al., 2000; Takai et al., 2001b; Huber et al., 2002; Nercessian et al., 2003). Oligonucleotide probes specic to Archaea and Korarchaeota have been designed over recent years (Stahl and Amann, 1991; Burggraf et al., 1997). However, the screening of the GenBank, RDP and ARB databases revealed that several recently deposited 16S rRNA sequences retrieved from hydrothermal environments were not targeted by the existing probes (S-DArch-0915-a-A-20, S-*-Kor-0546-a-A-20, S-*-Kor-0604-aA-20, S-*-Kor-1135-a-A-20), justifying the development of updated probes. Probes encompassing thermophilic cultured Archaea Three order-, three family- and three genus-level probes were designed to target most of the thermophilic Archaea (Table 1). The sequence of S-O-Tcl-1408-a-A-18 perfectly matched the sequences of all members of the order Thermococcales (group 2 in Fig. 1) that includes chemoorga 2004 Blackwell Publishing Ltd, Environmental Microbiology, 6, 170182

noheterotrophic hyperthermophiles and encompasses the genera Thermococcus, Pyrococcus and Palaeococcus (Takai et al., 2000; Boone et al., 2001). The probe S-OSulf-1045-a-A-18 perfectly matched the sequences of all thermoacidophilic chemoorganotrophs of the order Sulfolobales (group 11 in Fig. 1) (Boone et al., 2001). The probe S-O-Dsfc-0736-a-A-21 was designed to target representatives of the order Desulfurococcales that encompass chemoorganoheterotrophic and chemolithoautotrophic hyperthermophiles (group 8 in Fig. 1) (Boone et al., 2001). It exhibited perfect matches with all Desulfurococcales sequences, except those of species of the genus Desulfurococcus [one G:A mismatch at position 747 (Escherichia coli numbering; Brosius et al., 1978)]. This probe was also found to match perfectly some sequences that are not afliated with the order Desulfurococcales such as species of the genera Thermocladium and Vulcanisaeta (Boone et al., 2001) and the environmental clone pJP89 (Barns et al., 1994). The probe S-ODsfc-0736-a-A-21 was, however, retained for further experiments because of the potential utility of its wide coverage. Three family- (S-F-Prd-0488-a-A-16, S-F-Thp-1225-aA-22 and S-F-Mcc-1109-b-A-20) and three genus-level probes (S-G-Mp-0431-a-A-20, S-G-Ign-0463-a-A-16 and S-G-Agb-0431-a-A-21) were designed to target most of 16S rRNA sequences of the Pyrodictiaceae, Thermoproteaceae and Methanocaldococcaceae, Methanopyrus, Ignicoccus and Archaeoglobus respectively. The probe SF-Prd-0488-a-A-16 (group 9 in Fig. 1) perfectly matched sequences of all species of the family Pyrodictiaceae, composed of hyperthermophilic chemolithoautotrophs or fermenters (Boone et al., 2001). Despite several attempts, we were unable to design a probe that targeted all members of the order Thermoproteales (group 12 in Fig. 1) (Boone et al., 2001), with a Tm lower than 76C and without altering the in silico specicity. We therefore designed probe S-F-Thp-1225-a-A-22 that perfectly matched all 16S rRNA sequences of the genera Pyrobaculum, Thermoproteus, Caldivirga and Vulcanisaeta, known as thermoacidophilic chemoorganoheterotrophs using sulphur, O2 or nitrate as electron acceptors (Boone et al., 2001; Itoh et al., 2002). However, it had one mismatch with the sequences of members of genera Thermocladium (C:T at position 1244, E. coli numbering) and Thermolum (C:A at position 1225, E. coli numbering). Contrary to the probe MCC1109 developed by Raskin et al. (1994), the degenerate probe S-F-Mcc-1109-b-A-20 perfectly matched the sequences of all hyperthermophilic methanogenic species of the family Methanocaldococcaceae (genera Methanocaldococcus and Methanotorris) (group 4 in Fig. 1) (Boone et al., 2001). It contained a slightly destabilizing G:T mismatch at position 1121 (E. coli numbering) with sequences of thermophilic and

172 O. Nercessian et al.

Table 1. Oligonucleotide probes targeting 16S rDNA sequences of thermophilic, hyperthermophilic and uncultured Archaea.

Probe namea Archaea Thermococcales (121) Archaeoglobus (15) Methanocaldococcaceae (15) DHVE 2 (18) DHVE 8 (9) Methanopyrus (7) Most of Desulfurococcales (60 + 7 Thermoproteales) Pyrodictiaceae (7 + 1 mammals) Ignicoccus (11 + 4 mammals) Sulfolobales (50) Thermoproteaceae except Thermocladium (23) Most of marine Crenarchaeota group I (127) 64 56 66 76 56 52 60 76 54 47 47 47 50 47 47 47 50 47 58 70 66 (68) 47 47 47 56 47

Probe sequence (5 3)b

Specicity (number of exact matches in GenBank)c

Theoretical Td (C)d 47 54 52 58g 58 52 52 70 52 47 54 65 47

Hyb. temp. (C)e

Wash. temp. (C)f

References

S-D-Arch-0915-b-A-17

CTCCCCCGCCAATTCCT

S-O-Tcl-1408-a-A-18 S-G-Agb-0431-a-A-21 S-F-Mcc-1109-b-A-20

ACGCTCCACCCCTTGTAG TTTAGGCACCCCGACAGCCCG GCAACATGGGGCRCGGGTCT

S-*-DHVE2-0392-a-A-20 S-*-DHVE8-1358-a-A-19 S-G-Mp-0431-a-A-20 S-O-Dsfc-0736-a-A-21 S-F-Prd-0488-a-A-16 S-G-Ign-0463-a-A-16 S-O-Sulf-1045-a-A-18 S-F-Thp-1225-a-A-22 S-*-MgI-0391-b-A-20

AAGGGCACTCGGGCTCCCCT ATTCGCCGAACGGTGCTAA TTACACCCCGGTACAGCCGC CCGTCGGGCGCGTTCCAGCCG CCGCTTACTCCCCCGC ACCCCCGCCTGTTTAC ACCTCCTCTCCGCGAGTC CCCGCCATTGCAGCTCGCGTGC AAATCACTCGGATTAACCTT

S-*-Kor-0554-a-A-18

AGGCCCAGTATGCGTGGG

Korarchaeota (12)

60

47

52

Modied from Stahl and Amann (1991) This study This study Modied from Raskin et al. (1994) This study This study This study This study This study This study This study This study Modied from Takai and Horikoshi (1999) This study

2004 Blackwell Publishing Ltd, Environmental Microbiology, 6, 170182

a. Arch, Archaea; Tcl, Thermococcales; Agb, Archaeoglobus; Mcc, Methanocaldococcaceae; DHVE 2, deep-sea hydrothermal vent euryarchaeotic group 2; DHVE 8, deep-sea hydrothermal vent euryarchaeotic group 8; Mp, Methanopyrus; Dsfc, Desulfurococcales; Prd, Pyrodictiaceae; Ign, Ignicoccus; Sulf, Sulfolobales; Thp, Thermoproteaceae except Thermocladium; MgI, marine group I; Kor, Korarchaeota. Probe names are according to the Oligonucleotide Probe Database nomenclature (Alm et al., 1996). b. R refers to A or G. c. See Fig. 1 for detailed coverage information. BLAST searches performed in March 2003. d. Theoretical temperature of denaturation (Td) calculated according to the formula 4 (A + T) + 2 (G +C) (Stahl and Amann, 1991). For the probe S-F-Mcc-1109-b-A-20, it depends whether R is considered as an A (66C) or a G (68C). e. Hybridization temperature (C) used in the specicity studies. f. Temperature (C) of the wash buffer used in the specicity studies. g. Probe S-F-Mcc-1109-b-A-20 was specic for 16S rRNA of the genera Methanotorris and Methanocaldococcus when washed at 58C. The probe was specic for 16S rRNA of the genera Methanotorris, Methanocaldococcus, Methanococcus and Methanothermococcus when washed at 56C.

16S rRNA probes for Archaea thriving in hot habitats 173 mesophilic methanogenic species of the genera Methanothermococcus and Methanococcus respectively. The probes S-G-Mp-0431-a-A-20 and S-G-Ign-0463-a-A-16 (groups 7 and 10 in Fig. 1 respectively) perfectly bound all sequences of the genera Methanopyrus and Ignicoccus (Boone et al., 2001). Contrary to other members of the order Desulfurococcales, species of Ignicoccus are obligate chemolithoautotrophic sulphur reducers (Boone et al., 2001). With the hyperthermophilic methanogens, these organisms probably represent the main primary producers in high-temperature marine environments. The probe S-G-Agb-0431-a-A-21 perfectly matched all sequences of the hyperthermophilic mixotrophic sulphateor sulphite- and thiosulphate-reducing organisms of the genus Archaeoglobus and environmental clones (i.e. VC2.1 Arc8, VC2.1Arc4 and pEPR796) retrieved from deep-sea hydrothermal vents (Reysenbach et al., 2000; Boone et al., 2001; Nercessian et al., 2003) (group 3 in Fig. 1). However, it contained major mismatches with sequences of species of genera Ferroglobus (A:A at position 444, E. coli numbering) and Geoglobus, and with environmental clones VC2.1 Arc2 (C:A at position 434, E. coli numbering), VC2.1Arc36 (A:A at position 444, E. coli numbering) and pMC2A228 (C:C at position 440, E. coli numbering) retrieved from deep-sea hydrothermal vents (Hafenbradl et al., 1996; Takai and Horikoshi, 1999; Reysenbach et al., 2000; Kashe et al., 2002). Probes encompassing uncultured organisms In addition to probes targeting cultured Archaea, we developed four oligonucleotide probes specic to as yet uncultured organisms. With the exception of marine group I Crenarchaeota (group 13 in Fig. 1) retrieved from various marine ecosystems (Vetriani et al., 1999; Massana et al., 2000; Huber et al., 2002), these uncultured organisms have only been detected in hydrothermal systems (Takai and Horikoshi, 1999; Takai and Sako, 1999; Reysenbach et al., 2000; Marteinsson et al., 2001; Takai et al., 2001b; Huber et al., 2002; Nercessian et al., 2003). The probe S-*-DHVE2-0392-a-A-20 (group 5 in Fig. 1) matched perfectly all sequences belonging to the deep-sea hydrothermal vent euryarchaeotic group 2 (DHVE 2; Takai and Horikoshi, 1999). The probe S-*-DHVE8-1358-a-A-19 (group 6 in Fig. 1) matched perfectly all sequences from the recently discovered environmental clade deep-sea hydrothermal vent euryarchaeotic group 8 (DHVE 8; Takai and Horikoshi, 1999). Burggraf et al. (1997) designed probes specic to the Korarchaeota (Barns et al., 1996). However, recently deposited korarchaeal 16S rRNA sequences retrieved from coastal and deep-sea hydrothermal vents contained several mismatches with the latter probes. We therefore designed the probe S-*-Kor0554-a-A-18 to encompass most of the 16S rRNA
2004 Blackwell Publishing Ltd, Environmental Microbiology, 6, 170182

sequences of Korarchaeota available in the databases (group 14 in Fig. 1). The probe S-*-MgI-0391-b-A-20 matched most sequences belonging to the marine group I Crenarchaeota (group 13 in Fig. 1) retrieved from various marine ecosystems (Vetriani et al., 1999; Massana et al., 2000; Huber et al., 2002). However, some sequences contained a slightly destabilizing T:G mismatch at positions 398 or 407 (E. coli numbering). Finally, a new general archaeal probe was developed in order to include the new archaeal lineage DHVE8 (Nercessian et al., 2003) (group 1 in Fig. 1). In contrast to the Archaea-specic probe S-D-Arch-0915-a-A-20 developed by Stahl and Amann (1991), the probe S-D-Arch-0915-aA-17 (group 1 in Fig. 1) perfectly matched the 16S rRNA from the DHVE8 lineage. However, similar to the probe SD-Arch-0915-a-A-20, the new probe still contained several strongly destabilizing mismatches with some DHVE2 (C:A at position 928) and all Korarchaeota sequences (C:A and T:G at positions 923 and 930). Specicity studies The specicity of selected oligonucleotide sequences revealed by comparison with available rRNA sequence databases was ensured by optimization of experimental hybridization conditions. The hybridization and posthybridization washing temperatures ensuring specicity were experimentally determined for the 14 probes characterized in this study (Table 1). The 14 identical membranes containing nucleic acids from the reference strains and environmental clones mentioned in Table 2 are shown in Fig. 2. Dot-blot hybridization experiments generally conrmed the in silico specicity analysis. Probe S-DArch-0915-a-A-17 gave positive signals for most of the archaeal nucleic acids. Conrming the in silico analysis, no hybridization signals were obtained for clones pEPR193, pEPR152 and pEPR153 (Fig. 2a, blots C4, G2 and G3 respectively) that belonged to the lineages DHVE2 or Korarchaeota. The organisms targeted by probes S-O-Tcl-1408-a-A-18 (Fig. 2b), S-G-Agb-0431a-A-21 (Fig. 2c), S-*-DHVE2-0392-a-A-20 (Fig. 2e), S-*-DHVE8-1358-a-A-19 (Fig. 2f), S-G-Mp-0431-a-A-20 (Fig. 2g), S-G-Ign-0463-a-A-16 (Fig. 2i), S-F-Prd-0463a-A-16 (Fig. 2j), S-O-Sulf-1045-a-A-18 (Fig. 2k) and S-*-MgI-0391-a-A-20 (Fig. 2m) were unambiguously discriminated from non-target strains. The probe S-F-Mcc1109-b-A-20 was found to be specic for mesophilic, thermophilic and hyperthermophilic methanogens from the order Methanococcales when washed at 56C (data not shown). It was specic for hyperthermophilic methanogens only when washed at 58C (Fig. 2d). This difference in specicity resulted from a slightly destabilizing G:T mismatch at position 1121 (E. coli numbering) in the sequences of Methanothermococcus thermolithotrophicus

174 O. Nercessian et al.

2004 Blackwell Publishing Ltd, Environmental Microbiology, 6, 170182

16S rRNA probes for Archaea thriving in hot habitats 175

Table 2. Reference strains and environmental clones used in this study. Reference strains or clonesa Methanocaldococcus jannaschii (DSM 2661 ) Methanotorris igneus (DSM 5666T) Methanothermococcus thermolithotrophicus (DSM 2095T) Methanococcus voltae (DSM 1537T) Thermococcus celer (DSM 2476T) Pyrococcus abyssi strain GE5 Archaeoglobus profundus (DSM 5631T) Methanopyrus kandleri (DSM 6324T) Methanoculleus marisnigri (DSM 1498T) Methanohalophilus mahii (DSM 5219T) pEPR809 (Methanocaldococcus spp.) pEPR743 (Thermococcus spp.) pEPR145 (Pyrococcus spp.) pEPR796 (Archaeoglobus spp.) pEPR829 (Methanopyrus spp.) pEPR717 (DHVE 2) pEPR719 (DHVE 2) pEPR193 (DHVE 2) pEPR824 (DHVE 8) pEPR895 (DHVE 8) pEPR731 (DHVE 8) Pyrodictium abyssi (DSM 6158T) Pyrolobus fumari (DSM 11204T) Ignicoccus pacicus (DSM 13166T) Staphylothermus marinus (DSM 3639T) Aeropyrum pernix (DSM 11879T) Thermococcus profundus (JCM 9378T) Desulfurococcus mobilis (DSM 2161T) Acidilobus aceticus (DSM 11585T) Sulfolobus shibatae (DSM 5389T) Metallosphaera sedula (DSM 5348T) Acidianus brierleyi (DSM 1651T) Thermoproteus tenax (DSM 2078T) Thermocladium modestius (JCM 0088T) Thermolum pendens (DSM 2475T) Pyrobaculum organotrophum (DSM 4185T) pEPR940 (Pyrodictium spp.) pEPR936 (Ignicoccus spp.) pEPR805 (Staphylothermus spp.) pEPR985 (Aeropyrum spp.) pEPR853 (marine Crenarchaeota group I) pEPR624 (marine Crenarchaeota group I) pEPR161 (marine Crenarchaeota group I) pEPR152 (Korarchaeota) pEPR153 (Korarchaeota) Desulfovibrio giganteus (DSM 4123T)
T

Position on blotb A1 A2 A3 A4 A5 A6 A7 B1 B2 B3 B4 B5 B6 B7 C1 C2 C3 C4 C5 C6 C7 D1 D2 D3 D4 D5 D6 D7 E1 E2 E3 E4 E5 E6 E7 F1 F2 F3 F4 F5 F6 F7 G1 G2 G3 G4

Reference Jones et al. (1983) Burggraf et al. (1990a) Huber et al. (1982) Balch et al. (1979) Zillig et al. (1983b) Erauso et al. (1993) Burggraf et al. (1990b) Kurr et al. (1991) Romesser et al. (1979) Paterek and Smith (1985) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Pley et al. (1991) Blochl et al. (1997) Huber et al. (2000) Fiala et al. (1986) Sako et al. (1996) Kobayashi et al. (1994) Zillig et al. (1982) Prokofeva et al. (2000) Grogan et al. (1990) Huber et al. (1989) Zillig et al. (1980) Zillig et al. (1981) Itoh et al. (1998) Zillig et al. (1983a) Huber et al. (1987) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Nercessian et al. (2003) Esnault et al. (1988)

a. Collection numbers of species or phylogenetic relatives of environmental clones pEPR are indicated in brackets. DSM, Deutsche Sammlung von Mikroorganismen und Zellkulturen (Braunschweig, Germany); JCM, Japanese Collection of Microorganisms (Saitama, Japan). b. See Fig. 2. For example, 16S rDNA of Methanocaldococcus jannaschii is located on dot A1 (lane A, column 1 in Fig. 2).

and Methanococcus voltae. Under the conditions used, the probe S-F-Thp-1225-a-A-22 was specic for members of the families Thermoproteaceae and Thermoliaceae. However, lower signal intensities, probably due to the presence of a single weakly destabilizing mismatch, were

observed for Thermocladium (family Thermoproteaceae) and Thermolum (family Thermoliaceae) (Fig. 2l). Our experimental conditions conrmed that probe S-O-Dsfc0736-a-A-16 matched perfectly nearly all sequences of the order Desulfurococcales and some of the order Ther-

Fig. 1. 16S rDNA phylogenetic tree showing the archaeal groups targeted by the newly designed probes. The tree was constructed using the neighbour-joining method (Saitou and Nei, 1987) and the correction of Jukes and Cantor (1969). Archaeal lineages marked group 1 to group 14 were targeted by the following probes: S-D-Arch-0915-b-A-17 (group 1), S-O-Tcl-1408-a-A-18 (group 2), S-G-Agb-0431-a-A-21 (group 3), S-FMcc-1109-b-A-20 (group 4), S-*-DHVE2-0392-a-A-20 (group 5), S-*-DHVE8-1358-a-A-19 (group 6), S-G-Mp-0431-a-A-20 (group7), S-O-Dsfc0736-a-A-21 (group 8), S-F-Prd-0488-a-A-16 (group 9), S-G-Ign-0463-a-A-16 (group 10), S-O-Sulf-1045-a-A-18 (group 11), S-F-Thp-1225-a-A22 (group 12), S-*-MgI-0391-b-A-20 (group 13), S-*-Kor-0554-a-A-18 (group 14). Bold sequences were used in the specicity studies (see Table 2 and Fig. 2). 2004 Blackwell Publishing Ltd, Environmental Microbiology, 6, 170182

176 O. Nercessian et al.

Fig. 2. Dot-blot analyses of probe specicities. The layout of the 46 target and non-target 16S rDNA sequences on blots is shown in Table 2. The blots were hybridized with the following probes: S-D-Arch-0915-b-A-17 (a), S-O-Tcl-1408-a-A-18 (b), S-G-Agb-0431-a-A-21 (c), S-F-Mcc-1109b-A-20 (d), S-*-DHVE2-0392-a-A-20 (e), S-*-DHVE8-1358-a-A-19 (f), S-G-Mp-0431-a-A-20 (g), S-O-Dsfc-0736-a-A-21 (h), S-F-Prd-0488-a-A-16 (i), S-G-Ign-0463-a-A-16 (j), S-O-Sulf-1045-a-A-18 (k), S-F-Thp-1225-a-A-22 (l), S-*-MgI-0391-b-A-20 (m), S-*-Kor-0554-a-A-18 (n). As a control, the 16S rDNA of Desulfovibrio giganteus (blot G4) yielded a positive signal when hybridized with the general bacterial probe S-D-Bact-0388-aA-18 (data not shown).

moproteales (Fig. 2h, blots E6 and E7), but not those of the genus Desulfurococcus (Fig. 2h, blot D7). Under lowstringency washing conditions (65C), signal intensities of targeted organisms were strong, but a faint positive signal was also observed for the clones pEPR152 and pEPR153 (Korarchaeota). Using higher stringency washing conditions (70C), poor uorescence intensities (Fig. 2h) were obtained for targeted organisms, but Korarchaeota sequences were efciently discriminated [probably because of the presence of a single weak destabilizing mismatch (G:T at position 749, E. coli numbering)]. Probe S-*-Kor-0554-a-A-18 gave a positive signal only when hybridized with nucleic acids of clone pEPR153, but failed to hybridize with clone pEPR152 [16S rRNA sequence of the latter archaeal clone had a C:T mismatch at position 565 (E. coli numbering)]. Detection of Archaea subgroups in environmental samples Archaeal 16S rDNA amplicons were obtained by polymerase chain reaction (PCR) from DNA isolated from deep-sea hydrothermal samples (Table 3). The amplication products were transferred onto positively charged nylon membranes. DNA xed to membranes was then hybridized against the 14 designed and validated probes under the conditions mentioned in Table 1 (Fig. 3). Probe S-D-Arch-0915-a-A-17 gave strong positive signals for all amplication products. All other probes, except those targeting members of Sulfolobales, Pyrodictiaceae, Thermoproteaceae and Korarchaeota, gave positive signals with different intensities depending on the sample. Our results conrmed the apparent absence of thermoacidophiles of the order Sulfolobales and Thermoproteaceae in deepsea hydrothermal vent environments. Although end-

member hydrothermal uid pH is usually below pH 4.5, Sulfolobales may not tolerate large uctuations in pH that probably occur in the zones of mixing of sea water and hydrothermal uids (Jannasch, 1995). The absence of members of Thermoproteaceae is more likely to result from their low tolerance of the high ionic strength of sea water and hydrothermal uid mixtures. Conversely, isolates and/or 16S rRNA sequences of Pyrodictiaceae and Korarchaeota have been retrieved from deep-sea hydrothermal environments (Boone et al., 2001; Teske et al.,

Fig. 3. Dot-blot hybridizations of archaeal amplicons from diverse deep-sea hydrothermal samples. The sample codes (A to I) are those reported in Table 3. The 16S rDNAs were hybridized with the following probes: D-Arch-0915-b-A-17 (1), S-O-Tcl-1408-a-A-18 (2), S-G-Agb0431-a-A-21 (3), S-F-Mcc-1109-b-A-20 (4), S-G-Mp-0431-a-A-20 (5), S-O-Dsfc-0736-a-A-21 (6), S-G-Ign-0463-a-A-16 (7), S-*-MgI-0391b-A-20 (8), S-*-DHVE2-0392-a-A-20 (9), S-*-DHVE8-1358-a-A-19 (10). See Table 1 and Fig. 1 for specicity and coverage. 2004 Blackwell Publishing Ltd, Environmental Microbiology, 6, 170182

16S rRNA probes for Archaea thriving in hot habitats 177 2002; Nercessian et al., 2003). This may suggest that, if present, they were probably too low in abundance in our sample to be detected. Probes targeting Thermococcales, Archaeoglobus spp. and Methanocaldococcaceae gave positive signals in most of the samples, conrming their widespread distribution in deep-sea hydrothermal ecosystems (Boone et al., 2001). Hybridization signals specic to Methanopyrus were obtained only in a few samples from EPR. As Methanopyrus- and Methanocaldococcus-like organisms were enriched from the MAR sediments (C. Jeanthon, unpublished data), but not or poorly detected by their specic probes, it is presumed that hyperthermophilic chemolithoautotrophic methanogens were present in low numbers in these samples. Although Desulfurococcales were present in all samples, the probes targeting lower phylogenetic levels yielded no (family Pyrodictiaceae) or few (genus Ignicoccus) signals. Major discrepancies (compare dots 6E to 6I with 7E to 7I in Fig. 3) could indicate that other known inhabitants of deep-sea hydrothermal vents, such as Staphylothermus spp., Aeropyrum spp. and Thermodiscus spp. (Takai and Sako, 1999; Boone et al., 2001; Takai et al., 2001b; Nercessian et al., 2003), might be present in the corresponding samples. However, we cannot exclude the possibility that as yet unidentied Desulfurococcales reacted with the probe S-O-Dsfc-0736-a-A-16. The as yet uncultured organisms targeted by the other probes developed in this study were present in most samples. Marine group I sequences have often been recovered in libraries from deep-sea and coastal hydrothermal vent samples (Moyer et al., 1998; Takai and Horikoshi, 1999; Huber et al., 2002; Nercessian et al., 2003). Several studies suggest that these non-thermophilic organisms may contribute signicantly to the mesopelagic microbial community (Karner et al., 2001) and that their occurrence in hydrothermal vent samples may be attributed to their presence in deep bottom water and their entrainment during subsurface mixing of sea water and hydrothermal uids (Huber et al., 2002; Nercessian et al., 2003). Our results are in agreement with these hypotheses as representatives of marine group I Crenarchaeota were mostly detected in sediments and in situ samplers but not in chimney samples. Inversely, sequences from uncultured Euryarchaeota (DHVE 2 and DHVE 8 groups) were not detected in sediments. Based on the high G+C contents of their 16S rRNA gene sequences, a possible thermophilic lifestyle has been proposed for these organisms (Takai et al., 2001b; Nercessian et al., 2003). Their preferential distribution in the chimney environment supports this hypothesis. Although our set of probes encompassed most of the known thermophilic archaeal lineages, few and weak signals were generally obtained with amplication products
Position on blotc Lane C Lane D Lane F Lane G Lane H Lane I ZnS diffuser containing sphalerite, pyrrhotite, chalcopyrite and isocubanite T = 4050C ZnS diffuser containing sphalerite, pyrrhotite, chalcopyrite, isocubanite and iron oxides T = 83170C IR9 IR12 PP29-37 (361376 N, 335415 W; 2300 m) PP29-37 (361376 N, 335415 W; 2300 m) Fragments of diffuse vent Fragments of diffuse vent (external wall) Lane A Lane B Lane E

Diffuse vent colonized by Alvinella spp. and covered by bacterial mats Diffuse vent (40270C) colonized by Alvinella spp. and covered by bacterial mats HS = 16.32 mM; FeS = 115 nA; Total Fe = 4.9 mM; Fe(II) = 3.8 mM; pH 5.2 Diffuse vent (40270C) colonized by Alvinella spp. and covered by bacterial mats Diffuse vent (50C) colonized by Alvinella spp. and covered by bacterial mats HS = 6.1 mM; FeS = 63.2 nA Diffuse vent ( 50C) colonized by Alvinella spp. and covered by bacterial mats HS = 6.1 mM; FeS = 63.2 nA Bottom part ( 7 cm) of an 15 cm-long core containing metals, calcite, siderite, and dolomite Bottom part ( 7 cm) of an 20 cm-long core containing metals, calcite, and siderite

Table 3. Characteristics of hydrothermal samples.

Sample name

EX36 EX39

EX26 EX27

EX42

2004 Blackwell Publishing Ltd, Environmental Microbiology, 6, 170182

IR3 IR4

a. Numbers in brackets indicate the duration (in days) of the in situ sampler deployments. b. Temperatures were taken by the thermal probes manipulated by the arms of the DSV Alvin (EX samples) and the ROV Victor (IR samples). Mn and O2 were not detected. c. See Fig. 3. For example, 16S rDNA amplicons of EX26 are located on lane A in Fig. 3.

Characteristics of the environmentb

East zone (361380 N, 335410 W; 2300 m) East zone (361380 N, 335410 W; 2300 m)

Bio9 vent (95033 N, 1041741 W; 2500 m) Bio9 vent (95033 N, 1041741 W; 2500 m)

Hydrothermal vent sites (co-ordinates, depth)

M vent (95083 N, 1041758 W; 2500 m) M vent (95083 N, 1041758 W; 2500 m)

M vent (95083 N, 1041758 W; 2500 m)

Hydrothermal sediment Hydrothermal sediment

In situ collector C (2) In situ collector D (2)

In situ collector A (5) In situ collector B (4)

In situ collector D (2)

Type of samplea

178 O. Nercessian et al. from MAR sediments. To elucidate the composition of these archaeal communities, we constructed 16S rDNA libraries from the sediment DNA extracts. Analysis of the cloned sequences revealed that, except for a few clones related to marine Crenarchaeota group I, all belonged to novel archaeal lineages (O. Nercessian, Y. Fouquet, C. Pierre, D. Prieur and C. Jeanthon, submitted). Because of the recognized biases introduced by using PCR for 16S rRNA gene amplication (von Wintzingerode et al., 1997), we cannot assume that the hybridization signal intensities reect the natural abundance of each targeted group. However, keeping in mind these constraints, the EPR archaeal community appeared to be generally more diverse than the MAR samples. As different DNA extraction procedures were performed on Pacic and Atlantic samples, we cannot exclude the possibility that they could have affected the observed compositions of archaeal communities. In addition, given that distinct archaeal communities were retrieved from in situ samplers, chimneys and hydrothermal uid samples (Takai and Horikoshi, 1999; Reysenbach et al., 2000; Takai et al., 2001b; Huber et al., 2002; Nercessian et al., 2003), the nature of the sample type may also have inuenced the composition of archaeal communities sampled. Analyses of higher numbers of comparable samples are therefore clearly needed to compare archaeal communities at both vent elds. Investigations of archaeal community diversity and structure have generally been achieved by cloning and sequence determination of 16S rDNA genes obtained by PCR amplication of DNA isolated from the samples. The sequencing of large numbers of cloned sequences, which is often required to detect the minor members in a given environmental sample, is expensive, time-consuming and labour intensive. In the course of this study, oligonucleotide probes targeting 16S rRNAs of dened groups of Archaea known to thrive in high-temperature environments were developed. They were subsequently used to screen samples in order rapidly to obtain indications of the presence of distinct lineages of Archaea. This allowed us (i) to conrm the widespread distribution of Thermococcales, Desulfurococcales, Methanocaldococcaceae and Archaeoglobus in deep-sea hydrothermal vent habitats, and the apparent absence of Sulfolobales and Thermoproteaceae; (ii) to give new insights into the distribution of uncultured lineages; and (iii) to guide us in the identication of samples suitable for further extensive studies. We demonstrated that this suite of oligonucleotide probes represents an efcient tool for qualitative characterization of archaeal communities after 16S rDNA PCR amplication. Further experiments should be conducted to determine the conditions needed for their application in quantitative analyses. These options should be particularly valuable if large numbers of samples are to be analysed to study spatial and temporal variations in archaeal communities in high-temperature habitats. Experimental procedures Organisms and culture conditions
The 26 reference strains and 20 recombinant clones used in this study are listed in Table 2. Most of the reference strains were obtained as active cultures from the Deutsche Sammlung von Mikroorganismen und Zellkulturen (Braunschweig, Germany) and the Japanese Collection of Microorganisms (Saitama, Japan). Pyrococcus abyssi strain GE5 was isolated in the laboratory. Methanoculleus marisnigri (DSM 1498T) and Methanohalophilus mahii (DSM 5219T) were kindly provided by B. Ollivier and M.-L. Fardeau (Laboratoire IRD de Microbiologie des Anarobies, Universit de Provence, Marseille, France). The reference organisms were cultured as described in the references cited in Table 2. Environmental archaeal 16S rDNA inserts cloned in the pCR-2.1 TOPO vector (Invitrogen) were obtained previously from several deep-sea hydrothermal vent DNA samples collected at 13N on the East Pacic Rise (EPR) (Nercessian et al., 2003).

Design and validation of oligonucleotide probes

Design. The oligonucleotide probes designed in this study are listed in Table 1. 16S rRNA sequences from targeted and non-targeted organisms were aligned using the function FASTALIGNER version 3.0 of the software ARB (http://www.arbhome.de). The oligonucleotide probes were designed manually or automatically with the PROBE_DESIGN function of ARB. In silico specicities were tested using the PROBE_MATCH, BLAST search and PROBE_MATCH functions of ARB, GenBank (http://www.ncbi.nlm.nih.gov/) and the RDP (http:// rdp.cme.msu.edu/) respectively. The self-probe dimers and hairpin formations were controlled with the PRIMERSELECT 3.11 software (DNASTAR). When possible, several criteria were applied to select suitable oligonucleotide probes, including (i) a length between 15 and 25 nucleotides; (ii) a G+C mol% content between 50% and 70%; (iii) internal positions of major mismatches with non-targeted organisms; and (iv) absence of self-probe dimers and hairpins. Probe optimization and specicity studies. Pure cultures of the reference strains (1025 ml) and recombinant clones (5 ml) were centrifuged (5000 g for 10 min at 4C), and the pellets were stored at -20C until they were used for nucleic acid extraction. Nucleic acids from reference strains and recombinant plasmids of environmental clones were extracted using the methods described by Charbonnier et al. (1995) and Sambrook et al. (1989) respectively. The 16S rRNA genes from reference strains were amplied by PCR using the universal reverse primer 1407R (5GACGGGGGGTGWGTRCAA-3) in conjunction with the archaeal forward primer 4F (5-TCCGGTTGATCCTGCCRG3) or the bacterial forward primer 8F (5-AGAGTTT GATYMTGGCTCAG-3). The 16S rDNA genes from environmental clones were amplied using M13F and M13R primers. Amplication mixtures consisted of (as nal concentration): 1 DNA polymerase buffer, 1.5 mM MgCl2,
2004 Blackwell Publishing Ltd, Environmental Microbiology, 6, 170182

16S rRNA probes for Archaea thriving in hot habitats 179

0.25 mM each dATP, dCTP, dGTP and dTTP, 0.2 mM each primer and 2 U of Taq DNA polymerase (Promega) in a nal volume of 50 ml. PCR cycles were performed in a Robocycler (Stratagene) as follows: one cycle at 95C for 5 min, 30 cycles at 95C for 1.5 min, 53C for 1.5 min, 72C for 2.5 min and one cycle at 72C for 8 min. Amplication products were checked for quality and quantity after electrophoresis on a 0.8% agarose gel containing 0.5 mg ml-1 ethidium bromide. The oligonucleotide probes were tested for specicity in dot-blot hybridization assays. Approximately 100 ng of 16S rDNA amplicons was suspended into 50 ml of sterile water, denatured for 5 min at 95C and immediately placed on ice for 5 min. Amplied products were blotted onto positively charged nylon membrane (Hybond-N+ Amersham Biosciences) using a Minifold I dot/slot system (Schleicher and Schuell) and immobilized by cross-linking after 2 min exposure to UV light. The oligonucleotide probes were 3 endlabelled with uorescein-11dUTP using Gene Images 3oligolabelling module (Amersham Biosciences) according to the manufacturers instructions. Membranes were rst incubated for 45 min at the appropriate hybridization temperature (Table 2) in hybridization buffer consisting of 5 SSC, 0.1% SDS, 20 diluted blocking reagent (Amersham Biosciences) and 0.5% (w/v) dextran sulphate in order to prevent nonspecic hybridizations. Specic oligonucleotide probes were then added at a nal concentration of 5 ng ml-1 and hybridized overnight at the appropriate temperature. The washing steps consisted of three stringency washes (1 SSC, 0.1% SDS) for 20 min at the wash temperature (Table 2). Fluorescein-11dUTP-labelled DNAs were then detected with an alkaline phosphatase-conjugated antibody. The uorescent signal intensity was detected with a Storm 860 (Amersham Biosciences) after 36 h of incubation at room temperature with the detection reagent. Pictures were acquired using the software package IMAGEQUANT (Amersham Biosciences) and assembled with Adobe PHOTOSHOP version 5.0. method (Stookey, 1970). Electrochemical analyses used a standard three-electrode cell. The working electrode was a gold amalgam (Au/Hg) electrode of 0.1 mm diameter made in commercially available polyethyl ether ketone (PEEK) tubing sealed with epoxy as described by Brendel and Luther (1995). Counter (Pt) and reference (Ag/AgCl) electrodes, each of 0.5 mm diameter, were made similarly. For the voltammetric measurements, the voltage range scanned was from -0.1 V to -2.0 V. In linear sweep voltammetry (LSV) and cyclic voltammetry (CV), scan rates of 200, 500 or 1000 mV-1 were run, depending on targeted chemical species. The parameters for square wave voltametry (SWV) were as follows: pulse height, 24 mV; step increment, 1 mV; frequency, 100 Hz; scan rate, 200 mV-1. LSV and CV were used to measure oxygen and sulphur species, while SWV was used for detection of metal redox species. Electrochemically conditioning the electrode between scans removed any chemical species from the surface of the electrode, restoring it for the next measurement. To remove any deposited Fe or Mn, the working electrode was conditioned at a potential of -0.1 V for 10 s (Brendel and Luther, 1995). Before sample measurements, standard curves were produced for O2, Mn and sulphur species, as described previously (Luther et al., 2001). DNA extraction, 16S rDNA amplication and dot-blot hybridizations. Nucleic acids from EPR samples were extracted as described previously (Nercessian et al., 2003), whereas those from MAR were obtained using the UltraClean DNA kit (Mobio Laboratories) according to the manufacturers instructions. The 16S rDNA genes were primarily amplied from DNA extracts using the conditions used before. A semi-nested PCR with the archaeal-specic primers 341F and 1407R was then performed as described previously (Nercessian et al., 2003) to obtain the desirable amounts of PCR products needed for hybridization experiments. Dot-blot hybridizations with 16S rRNA oligonucleotide probes were conducted using the experimental conditions determined before.

Application of probes on 16S rDNAs obtained from hydrothermal samples.

Sampling and chemical analyses. Nine deep-sea hydrothermal vent samples collected during the cruises Iris [June 2001, Rainbow vent eld at 36138 N and 33541 W on the Mid-Atlantic Ridge (MAR)] and Extreme2001 (October 2001, 9508 N and 104175 W on the EPR) were used as sources of environmental archaeal 16S rDNAs. Samples from 9N EPR were obtained from in situ samplers (Nercessian et al., 2003) designed to collect microorganisms discharged by hydrothermal uid emitted by active vents. The samplers were deployed for 25 days on two different hydrothermal active areas by the submersible Alvin (Table 3). Samples from the Rainbow vent eld consisted of cores of hydrothermally inuenced sediments and fragments of active diffuse vents collected by the ROV Victor (Table 3). For 9N EPR samples, small volumes of uids were collected using the Sipper sampler (Di Meo et al., 1999) for shipboard chemical analyses using voltammetric and colorimetric methods. Aliquots of the samples were separated for dissolved Fe(II) and Fe(total) [dened as Fe(total) = dissolved Fe(III) + dissolved Fe(II)] and analysed by colorimetry using a Spectronic 601 (Milton Roy) according to the ferrozine
2004 Blackwell Publishing Ltd, Environmental Microbiology, 6, 170182

Acknowledgements
The authors are grateful to Yves Fouquet (chief scientist of the Iris cruise) for inviting us to participate in the Iris cruise and analysis of the mineralogy of MAR samples. Brian Glazer is also acknowledged for the chemical analyses of the 9N diffuse vent uids The authors also thank Barbara Campbell for scientic discussion and facilities during the cruise Extreme2001. The Iris cruise was organized by IFREMER with the RV LAtalante and the ROV Victor. The Extreme2001 cruise was organized by Woods Hole Institute with RV Atlantis and the DSV Alvin. We thank the captains and the crews of LAtalante and Atlantis and the pilots of DSV Alvin and ROV Victor for their skilful operations. Our thanks also go to MarieLaure Fardeau and Bernard Ollivier for providing reference strains. We thank Erwan Corre, Isabelle Mary and Fabrice Not for scientic discussion. This work was supported by the programmes Dorsales, CNRS/Rhne-Poulenc and Intas 991250, and a PRIR from the Conseil Rgional de Bretagne. The work performed at Plouzan was made possible by a FEMS young researcher fellowship awarded to M. Prokofeva in 2001. O. Nercessian is supported by a grant from the Communaut Urbaine de Brest.

180 O. Nercessian et al. References

Alm, E.W., Oerther, D.B., Larsen, N., Stahl, D.A., and Raskin, L. (1996) The Oligonucleotide Probe Database. Appl Environ Microbiol 65: 270277. Balch, W.E., Fox, G.E., Magrum, C.J., Woese, C.R., and Wolfe, R.S. (1979) Methanogens: reevaluation of a unique biological group. Microbiol Rev 43: 260296. Barns, S.M., Fundyga, R.E., Jeffries, M.W., and Pace, N.R. (1994) Remarkable archaeal diversity detected in a Yellowstone National Park hot spring environment. Proc Natl Acad Sci USA 91: 16091613. Barns, S.M., Delwiche, C.F., Palmer, J.D., and Pace, N.R. (1996) Perspectives on archaeal diversity, thermophily and monophyly from environmental rRNA sequences. Proc Natl Acad Sci USA 93: 91889193. Bintrim, S.B., Donohue, T.J., Handelsman, J., Roberts, G.P., and Goodman, R.M. (1997) Molecular phylogeny of Archaea from soil. Proc Natl Acad Sci USA 94: 277282. Blochl, E., Rachel, R., Burggraf, S., Hafenbradl, D., Jannasch, H.W., and Stetter, K.O. (1997) Pyrolobus fumarii, gen. and sp. nov., represents a novel group of Archaea, extending the upper temperature limit for life to 113 degrees C. Extremophiles 1: 1421. Boone, D.R., Castenholz, R.W., and Garrity, G.M. (2001) Bergeys Manual of Systematic Bacteriology, Vol. 1, 2nd edn. New York: Springer-Verlag. Brendel, P.J., and Luther, G.W. (1995) Development of a gold amalgam voltammetric microelectrode for the determination of dissolved Fe, Mn, O2, and S(-II) in porewaters of marine and freshwater sediments. Environ Sci Technol 29: 751761. Brosius, J., Palmer, J.L., Kennedy, J.P., and Noller, H.F. (1978) Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli. Proc Natl Acad Sci USA 75: 48014805. Burggraf, S., Fricke, H., Neuner, A., Kristjansson, J., Rouvier, P., Mandelco, L., et al. (1990a) Methanococcus igneus sp. nov., a novel hyperthermophilic methanogen from a shallow submarine hydrothermal system. Syst Appl Microbiol 13: 263269. Burggraf, S., Jannasch, H.W., Nicolaus, B., and Stetter, K.O. (1990b) Archaeoglobus profundus, sp. nov., represents a new species within the sulfate-reducing archaebacteria. Syst Appl Microbiol 13: 2428. Burggraf, S., Heyder, P., and Eis, N. (1997) A pivotal Archaea group. Nature 385: 780. Charbonnier, F., Forterre, P., Erauso, G., and Prieur, D. (1995) Purication of plasmids from thermophilic and hyperthermophilic Archaea. In Thermophiles, Archaea a Laboratory Manual. Robb, F.T., and Place, A.R. (eds). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, pp. 8790. DeLong, E.F. (1992) Archaea in coastal marine environments. Proc Natl Acad Sci USA 89: 56855689. Di Meo, C.A., Wakeeld, J.R., and Cary, S.C. (1999) A new device for sampling small volumes of water from marine micro-environments. Deep-Sea Res I 46: 12791287. Erauso, G., Reysenbach, A.L., Godfroy, A., Meunier, J.R., Crump, B., Partensky, F., et al. (1993) Pyrococcus abyssi sp. nov., a new hyperthermophilic archaeon isolated from a deep-sea hydrothermal vent. Arch Microbiol 160: 338 349. Esnault, G., Caumette, P., and Garcia, J.L. (1988) Characterization of Desulfovibrio giganteus sp. nov., a sulfate reducing bacterium isolated from a brackish coastal lagoon. Syst Appl Microbiol 10: 147151. Fiala, G., Stetter, K.O., Jannasch, H.W., Langworthy, T.A., and Madon, J. (1986) Staphylothermus marinus sp. nov. represents a novel genus of extremely thermophilic submarine heterotrophic archaebacteria growing up to 98C. Syst Appl Microbiol 8: 106113. Garrity, G.M., and Holt, J.G. (2001) The road map to the manual. In Bergeys Manual of Systematic Bacteriology, Vol. 1, 2nd edn. Boone, D.R., Castenholz, R.W., and Garrity, G.M. (eds). New York: Springer-Verlag, pp. 119166. Grogan, D., Palm, P., and Zillig, W. (1990) Isolate B12, which harbours a virus-like element, represents a new species of the archaebacterial genus Sulfolobus, Sulfolobus shibatae, sp. nov. Arch Microbiol 154: 594599. Hafenbradl, D., Keller, M., Dirmeier, R., Rachel, R., Rossnagel, P., Burggraf, S., et al. (1996) Ferroglobus placidus gen. nov., sp. nov., a novel hyperthermophilic archaeum that oxidizes Fe2+ at neutral pH under anoxic conditions. Arch Microbiol 166: 308314. Huber, G., Spinnler, C., Gambacorta, A., and Stetter, K.O. (1989) Metallosphaera sedula gen. and sp. nov. represents a new genus of aerobic, metal-mobilizing, thermoacetophilic archaebacteria. Syst Appl Microbiol 12: 3847. Huber, H., Thomm, M., Knig, H., Thies, G., and Stetter, K.O. (1982) Methanococcus thermolithotrophicus a novel thermophilic lithotrophic methanogen. Arch Microbiol 132: 47 50. Huber, H., Burggraf, S., Mayer, T., Wyschkony, I., Rachel, R., and Stetter, K.O. (2000) Ignicoccus gen. nov., a novel genus of hyperthermophilic, chemolithoautotrophic Archaea, represented by two new species, Ignicoccus islandicus sp. nov. and Ignicoccus pacicus sp. nov. Int J Syst Evol Microbiol 50: 20932100. Huber, J.A., Buttereld, D.A., and Baross, J.A. (2002) Temporal changes in archaeal diversity and chemistry in a midocean ridge subseaoor habitat. Appl Environ Microbiol 68: 15851594. Huber, R., Kristjansson, J.K., and Stetter, K.O. (1987) Pyrobaculum gen. nov., a new genus of neutrophilic, rodshaped archaebacteria from continental solfataras growing optimally at 100C. Arch Microbiol 149: 95101. Hugenholtz, P. (2002) Exploring prokaryotic diversity in the genomic area. Genome Biol 3: 18. Itoh, T., Suzuki, K., and Nakase, T. (1998) Thermocladium modestius gen. nov., sp. nov., a new genus of rod-shaped, extremely thermophilic crenarchaeote. Int J Syst Bacteriol 48: 879887. Itoh, T., Suzuki, K., and Nakase, T. (2002) Vulcanisaeta distributa gen. nov., sp. nov. and Vulcanisaeta souniana sp. nov., novel hyperthermophilic, rod-shaped crenarchaeotes isolated from hot springs in Japan. Int J Syst Evol Microbiol 52: 10971104. Jannasch, H.W. (1995) Microbial interactions with hydrothermal uids. In Seaoor Hydrothermal Systems: Physical, Chemical, Biological, and Geological Interactions. Humphris, S.E., Zierenberg, R.A., Mullineaux, L.S.,
2004 Blackwell Publishing Ltd, Environmental Microbiology, 6, 170182

16S rRNA probes for Archaea thriving in hot habitats 181

and Thomson, R.E. (eds). Washington: American Geophysical Union, pp. 273296. Jones, W.J., Leigh, J.A., Mayer, F., Woese, C.R., and Wolfe, R.S. (1983) Methanococcus jannaschii sp. nov., an extremely thermophilic methanogen from a submarine hydrothermal vent. Arch Microbiol 136: 254261. Jukes, T.H., and Cantor, C.R. (1969) Evolution of protein molecules. In Mammalian Protein Metabolism. Munro, H.N. (ed.). New York: Academic Press, pp. 21132. Karner, M.B., DeLong, E.F., and Karl, D.M. (2001) Archaeal dominance in the mesopelagic zone of the Pacic Ocean. Nature 409: 507510. Kashe, K., Tor, J.M., Holmes, D.E., Gaw Van Praagh, C.V., Reysenbach, A.L., and Lovley, D.R. (2002) Geoglobus ahangari gen. nov., sp. nov., a novel hyperthermophilic archaeon capable of oxidizing organic acids and growing autotrophically on hydrogen with Fe(III) serving as the sole electron acceptor. Int J Syst Evol Microbiol 52: 719728. Kobayashi, T., Kwak, Y.S., Akiba, T., Kudo, T., and Horikoshi, K. (1994) Thermococcus profundus sp. nov., a new hyperthermophilic archaeon isolated from a deep-sea hydrothermal vent. Syst Appl Microbiol 17: 232236. Kurr, M., Huber, R., Knig, H., Jannasch, H.W., Fricke, H., Trincone, A., et al. (1991) Methanopyrus kandleri, gen. and sp. nov. represents a novel group of hyperthermophilic methanogens, growing at 110C. Arch Microbiol 156: 239 247. Luther, G.W., Glazer, B.T., Hohmann, L., Popp, J.I., Taillefert, M., Rozan, T.F., et al. (2001) Sulfur speciation monitored in situ with solid state gold amalgam voltammetric microelectrodes: polysuldes as a special case in sediments, microbial mats and hydrothermal vent waters. J Environ Monit 3: 6166. Marteinsson, V.T., Kristjansson, J.K., Kristmannsdottir, H., Dahlkvist, M., Saemundsson, K., Hannington, M., et al. (2001) Discovery and description of giant submarine smectite cones on the seaoor in Eyjafjordur, northern Iceland, and a novel thermal microbial habitat. Appl Environ Microbiol 67: 827833. Massana, R., DeLong, E.F., and Pedros-Alio, C. (2000) A few cosmopolitan phylotypes dominate planktonic archaeal assemblages in widely different oceanic provinces. Appl Environ Microbiol 66: 17771787. Moyer, C.L., Tiedje, J.M., Dobbs, F.C., and Karl, D.M. (1998) Diversity of deep-sea hydrothermal vent Archaea from Loihi Seamount, Hawaii. Deep-Sea Res II 45: 303 317. Nercessian, O., Reysenbach, A.L., Prieur, D., and Jeanthon, C. (2003) Archaeal diversity associated with in situ samplers deployed on hydrothermal vents on the East Pacic Rise (13N). Environ Microbiol 5: 492502. Orphan, V.J., Taylor, L.T., Hafenbradl, D., and Delong, E.F. (2000) Culture-dependent and culture-independent characterization of microbial assemblages associated with high-temperature petroleum reservoirs. Appl Environ Microbiol 66: 700711. Paterek, J.R., and Smith, P.H. (1985) Isolation and characterization of a halophilic methanogen from Great Salt Lake. Appl Environ Microbiol 50: 877881. Pley, U., Schipka, A., Gambacorta, A., Jannasch, H.W., Fricke, H., Rachel, R., and Stetter, K.O. (1991) Pyrodictium
2004 Blackwell Publishing Ltd, Environmental Microbiology, 6, 170182

abyssi, sp. nov. represents a novel heterotrophic marine archaeal hyperthermophile growing at 110C. Syst Appl Microbiol 14: 245253. Prokofeva, M.I., Miroshnichenko, M.L., Kostrikina, N.A., Chernyh, N.A., Kuznetsov, B.B., Tourova, T.P., and BonchOsmolovskaya, E.A. (2000) Acidilobus aceticus gen. nov., sp. nov., a novel anaerobic thermoacidophilic archaeon from continental hot vents in Kamchatka. Int J Syst Evol Microbiol 50: 20012008. Raskin, L., Stromley, J.M., Rittmann, B.E., and Stahl, D.A. (1994) Group-specic 16S rRNA hybridization probes to describe natural communities of methanogens. Appl Environ Microbiol 60: 12321240. Reysenbach, A.L., Longnecker, K., and Kirshtein, J. (2000) Novel bacterial and archaeal lineages from an in situ growth chamber deployed at a Mid-Atlantic Ridge hydrothermal vent. Appl Environ Microbiol 66: 37983806. Romesser, J.A., Wolfe, R.S., Mayer, F., Spiess, E., and Walther-Mauruschat, A. (1979) Methanogenium, a new genus of marine methanogenic Bacteria, and characterization of Methanogenium cariaci sp. nov. and Methanogenium marisnigri sp. nov. Arch Microbiol 121: 147153. Saitou, N., and Nei, M. (1987) The neighbour joining method: a new tool for reconstructing phylogenetic trees. Mol Biol Evol 4: 406425. Sako, Y., Nomura, N., Uchida, A., Ishida, Y., Morii, H., Koga, Y., et al. (1996) Aeropyrum pernix gen. nov., sp. nov., a novel aerobic hyperthermophilic archaeon growing at temperatures up to 100 degrees C. Int J Syst Bacteriol 46: 10701077. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989) Molecular Cloning: a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Stahl, D.A., and Amann, R. (1991) Development and application of nucleic acid probes. In Nucleic Acids Techniques in Bacterial Systematics. Stackebrandt, E., and Goodfellow, E. (eds). Chichester: John Wiley & Sons, pp. 205248. Stookey, L.L. (1970) Ferrozine a new spectrophotometric reagent for iron. Anal Chem 42: 779781. Takai, K., and Horikoshi, K. (1999) Genetic diversity of Archaea in deep-sea hydrothermal vent environments. Genetics 152: 12851297. Takai, K., and Sako, Y. (1999) A molecular view of archaeal diversity in marine and terrestrial hot water environments. FEMS Microbiol Ecol 28: 177188. Takai, K., Sugai, A., Itoh, T., and Horikoshi, K. (2000) Palaeococcus ferrophilus gen. nov., sp. nov., a barophilic, hyperthermophilic archaeon from a deep-sea hydrothermal vent. Int J Syst Evol Microbiol 50: 489500. Takai, K., Moser, D.P., DeFlaun, M., Onstott, T.C., and Frederickson, J.K. (2001a) Archaeal diversity in waters from deep South African gold mines. Appl Environ Microbiol 67: 36183629. Takai, K., Komatsu, T., Inagaki, F., and Horikoshi, K. (2001b) Distribution of Archaea in a black smoker chimney structure. Appl Environ Microbiol 67: 36183629. Teske, A., Hinrichs, K.U., Edgcomb, V., de Vera Gomez, A., Kysela, D., Sylva, S.P., et al. (2002) Microbial diversity of hydrothermal sediments in the Guaymas Basin: evidence for anaerobic methanotrophic communities. Appl Environ Microbiol 68: 19942007.

182 O. Nercessian et al.

Vetriani, C., Jannasch, H.W., MacGregor, B.J., Stahl, D.A., and Reysenbach, A.L. (1999) Population structure and phylogenetic characterization of marine benthic Archaea in deep-sea sediments. Appl Environ Microbiol 65: 4375 4384. von Wintzingerode, F., Gobel, U.B., and Stackebrandt, E. (1997) Determination of microbial diversity in environmental samples: pitfalls of PCR-based rRNA analysis. FEMS Microbiol Rev 21: 213229. Woese, C.R., Kandler, O., and Wheelis, M.L. (1990) Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc Natl Acad Sci USA 87: 45764579. Zillig, W., Stetter, K.O., Wunderl, S., Schulz, W., Priess, H., and Scholz, I. (1980) The SulfolobusCaldariella group: taxonomy on the basis of the structure of DNA dependent RNA polymerases. Arch Microbiol 125: 259269. Zillig, W., Stetter, K.O., Schfer, W., Janekovic, D., Wunderl, S., Holz, J., and Palm, P. (1981) Thermoproteales: a novel type of extremely thermoacidophilic anaerobic archaebacteria isolated from Icelandic solfataras. Zentbl Bakteriol Mikrobiol Hyg 1 Abt Orig C 2: 205227. Zillig, W., Stetter, K.O., Prangishvilli, D., Schfer, W., Wunderl, S., Jankovic, D., et al. (1982) Desulfurococcaceae, the second family of the extremely thermophilic, anaerobic, sulfur-respiring Thermoproteales. Zentbl Bakteriol Hyg Abt Orig C 3: 304317. Zillig, W., Gierl, A., Schreiber, G., Wunderl, S., Janekovic, D., Stetter, K.O., and Klenk, H.P. (1983a) The archaebacterium Thermolum pendens represents a novel genus of the thermophilic, anaerobic sulfur respiring Thermoproteales. Syst Appl Microbiol 4: 7987. Zillig, W., Holz, L., Janekovic, D., Schfer, W., and Reiter, W.D. (1983b) The archaebacterium Thermococcus celer represents a novel genus within the thermophilic branch of the archaebacteria. Syst Appl Microbiol 4: 8894.

2004 Blackwell Publishing Ltd, Environmental Microbiology, 6, 170182