Articles in PresS. Am J Physiol Heart Circ Physiol (September 10, 2010). doi:10.1152/ajpheart.00168.

2010

H-00168-2010_R4/1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Correspondence: Peter M. Kang, MD, Cardiovascular Institute, Beth Israel Deaconess Medical Center, 3 Blackfan Circle, CLS 910, Boston, MA 02215. Tel: (617) 735-4290; Fax: (617) 735-4202; E-mail: pkang@bidmc.harvard.edu Running title: Caspase-independent apoptosis in heart failure Soochan Bae, Parco M. Siu, Sangita Choudhury, Qingen Ke, Jun H. Choi, Young Y. Koh, Peter M. Kang Cardiovascular Institute, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, MA. Delayed activation of caspase-independent apoptosis during heart failure in transgenic mice overexpressing caspase inhibitor, CrmA

Copyright 2010 by the American Physiological Society.

H-00168-2010_R4/2 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 Key words: AIF, PARP-1, doxorubicin, mortality, cardiomyopathy Abstract Although caspase activation is generally thought to be necessary to induce apoptosis, recent evidence suggests that apoptosis can be activated in the setting of caspase inhibition. In this study, we test the hypothesis that caspase-independent apoptotic pathways contribute to the development of heart failure in the absence of caspase activation. METHODS AND RESULTS: Acute cardiomyopathy was induced using a single dose of doxorubicin (DOX, 20 mg/kg) injected into male wild-type (WT) and transgenic (Tg) mice with cardiac-specific expression of CrmA, a known caspase inhibitor. Early (6 day) survival was significantly better in CrmA Tg (81%) than WT mice (38%). Twelve days after DOX injection, however, the mortality benefit had dissipated, and increased cardiac apoptosis was observed in both groups. There was, however, a significantly greater release of apoptosis inducing factor (AIF) from mitochondria to cytosol in CrmA Tg compared to WT mice, which suggests that an enhancement of activation in caspase-independent apoptotic pathways had occurred. Administration of a polyADP ribose polymerase 1 (PARP-1) inhibitor, 4-AN, to DOX treated mice resulted in significantly improved cardiac function, a significant blockade of AIF released from mitochondria, and decreased cardiac apoptosis. There were also significantly improved survival in WT (18% no 4-AN vs 89% with 4-AN) and CrmA Tg (13% no 4-AN vs 93% with 4-AN) mice 12 days after DOX injection. CONCLUSIONS: These findings suggest that apoptosis can be induced in the heart lacking caspase activation via caspase-independent pathways, and that enabling the inhibition of AIF activation may provide a significant cardiac benefit.

H-00168-2010_R4/3 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 Introduction Apoptosis is a tightly regulated, cell deletion process known to play an important role in various cardiovascular diseases, such as myocardial infarction, reperfusion injury, and the development of heart failure (15, 19). Although the caspases, a family of cysteine proteases, have been thought of as the critical enzymes in the induction and execution of apoptosis, there is accumulating evidence to suggest that caspase independent pathways play a significant role in cardiac cell death (3). The potential importance of caspase-independent pathways in the heart is highlighted by the fact that cardiomyocytes contain high levels of endogenous caspase inhibitors, which renders them relatively resistant to caspase-dependent apoptosis (20). Although some studies have shown that caspase inhibition reduces the acute loss of myocardium in various animal models (17, 38), other studies indicate that caspase inhibition might not be able to completely inhibit apoptosis (7, 25). Because of its potentially significant contribution to cell death in the heart, it is important to define the role of the caspase-independent pathway in cardiac apoptosis more fully. The best studied example of caspase-independent apoptosis involves apoptosis inducing factor (AIF) (5, 8, 9, 28, 34). AIF is an NADH-oxidase produced as a 67-kDa protein containing an N-terminal mitochondrial localization signal sequence (28, 34). It is processed into a 57-kDa mature form by calpain in mitochondria, released into the cytosol in response to apoptotic stimulation and is able to translocate into the nucleus and induce DNA fragmentation without caspase activation (20). This sequence of events is supported by evidence that AIF microinjected into cells can induce apoptotic changes, such as chromatin condensation, that cannot be blocked by caspase inhibition alone, as, for instance, by zVAD.fmk or the over-expression of Bcl-2 (5, 20, 28). Furthermore, AIF can trigger DNA fragmentation in Apaf-1 and caspase-9 deficient cells (5), an

H-00168-2010_R4/4 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 Materials and Methods Generation of CrmA transgenic (CrmA Tg) mice A schematic diagram of the construct used to generate Tg mice is shown in Figure 1A. Cardiac specific expression was achieved using MHC promoter. The genotypes of CrmA transgenic mice were identified by polymerase chain reaction (PCR) with PCR primers as follows: forward MHC: 5'-CGGTGTAAAAGAGGCAGGG AAG-3'; and reverse MHC: 5'ACTGACGAGATTGACGGTGGAG -3'. CrmA Tg mice were identified by the appearance of a effect that is probably mediated through the direct activation of caspase-3 (16) by AIF. In the heart, AIF has been implicated in apoptosis induced by oxidative stress and heart failure (6, 32). Its mature form is released, together with cytochrome c, from mitochondria to the cytosol in ischemic neonatal cardiomyocytes characterized by caspase-independent DNA degradation (4). Several studies have shown that AIF is regulated by polyADP ribose polymerase 1 (PARP-1), a highly conserved 116-kDa nuclear enzyme, involved in DNA repair (40). PARP-1 facilitates both the release of AIF from mitochondria and AIF nuclear translocation without the mediation of Bcl-2 proteins and caspase activation (1, 13, 29, 40). In the present study, we used alpha myosin heavy chain (MHC) promotor to generate transgenic (Tg) mice with cardiac-specific expression of cytokine response modifier A (CrmA), a known inhibitor of caspases (10, 30, 41), to determine whether caspase-independent apoptosis is activated in the setting of caspase inhibition in vivo. Using acute doxorubicin (DOX)-induced cardiomyopathy with significant cardiac apoptosis (26, 31), we sought to define the contribution of caspase-independent apoptosis, and to investigate its role in the development of heart failure by administering 4-Amino-1,8-naphthalimide (4-AN), a potent (PARP-1) inhibitor.

H-00168-2010_R4/5 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 Hemodynamic measurements Baseline cardiac function was analyzed using echocardiography. For cardiac functional analysis 10 days after DOX injection, which is just prior to the time point at which the most significant DOX-induced mortality is observed, we used the left ventricular (LV) pressurevolume loop measurement. This method uniquely provides measures of left ventricular (LV) performance that are more specific to the heart and less affected by vascular loading conditions (27), which may be particularly important in our acute heart failure model. Pressure-volume parameters were measured under isoflurane (2%) inhalant anesthesia using a 1.4 Fr. micro-tip DOX-induced cardiomyopathy and 4-AN treatment Twelve-week old, male CrmA Tg mice and wild type (WT) littermates were treated with a single intraperitoneal (ip.) injection of 20 mg/kg DOX (Bedford labs, Bedford, OH), a dose shown to induce significant acute heart failure in 1-2 weeks (18, 23). Control mice were treated with an equal volume of vehicle ip., and all animals were observed daily for signs of heart failure. To determine the effect of PARP inhibition, WT and CrmA mice were treated daily with PARP-1 inhibitor, 4-AN (3mg/kg/day, ip., Biomol, Plymouth Meeting, PA) starting 1 day before the DOX injection. 525-bp band (Figure 1B). Western blot analysis for CrmA was performed with anti-CrmA antibody (BD Pharmingen, San Diego, CA). The investigations conform to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH publication no. 85-23, revised 1996), and were approved by the Institutional Animal Care and Use Committee at Beth Israel Deaconess Medical Center.

H-00168-2010_R4/6 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 Results Improvement in early, but not late, survival in CrmA Tg mice after DOX administration CrmA transgenic mice showed cardiac specific expression of CrmA as determined by protein expression (Figure 1C and 1D), but no morphological or echocardiographic differences Statistical analyses All data are expressed as mean SEM. Statistical analyses between two groups were performed with unpaired Student t tests. To test the significance of hemodynamic changes, we conducted two-way ANOVAs followed by Bonferroni post hoc analysis using GraphPad Prism5.0 (San Diego, CA). Survival rates after doxorubicin were analyzed with the Wilcoxon test or log-rank test. Probability (p) values of <0.05 were considered significant. Biochemical and histological analyses Western immunoblot analyses, the assays for caspase-3, -8, and -9, and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining, and immunohistochemistry for AIF were preformed as described previously (11, 14, 32). More detailed descriptions of the analyses are outlined in the Online Supplementary Information. pressure-volume catheter (Scisense Inc, Ontario, Canada) inserted into the right common carotid artery and advanced into the left ventricle. Data was recorded using a Powerlab system (ADInstruments, Colorado Springs, CO). Beat by beat pressure-volume parameters including stroke work (SW), cardiac output (CO), preload, afterload, and contractility were measured and analyzed using CardioSoft Pro software (CardioSoft, Houston, TX).

H-00168-2010_R4/7 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 from WT mice at baseline. (Supplement Table 1 and Supplement Table 2) Initially, to determine whether the cardiac-specific inhibition of caspase has an effect on mortality, DOX, which has been shown to induce acute cardiac dysfunction and death associated with the activation of cardiac apoptosis, was injected into WT and CrmA Tg mice. We compared four groups of mice: 1) WT+Vehicle, 2) WT+DOX, 3) CrmA Tg+Vehicle, and 4) CrmA Tg+DOX. As expected, there were no deaths associated with vehicle injection (Figure 1E), but DOX caused a significant increase in mortality in both WT and Crm Tg mice. The increase in mortality was not uniform, however. Six days after DOX injection, survival was significantly greater in CrmA Tg (81%) compared to WT mice (38%). (Figure 1E) Furthermore, at 12 days CrmA Tg mice no longer displayed a relative survival benefit (5% CrmA Tg vs 10% WT, p=not significant). We also measured cardiac function using the LV pressure-volume loop 5 and 10 days after DOX or control vehicle injection. Since changes in molecular and hemodynamic parameters precede changes in mortality, the hemodynamic and molecular analyses performed at 5 and 10 days correspond to the mortality findings at 6 days, where the peak mortality difference is found, and 12 days. Although baseline cardiac function in untreated WT and CrmA Tg mice was similar, (Supplement Table 2), a significant decrease in cardiac function was evident in WT, but not CrmA Tg, mice 5 days after DOX treatment (Table 1). However, after 10 days, there was no longer any difference between WT and CrmA Tg mice, and both groups showed a significant and similar decrease in cardiac function compared with controls (Table 2). This finding suggests that the early survival benefit in CrmA Tg mice noted at 6 days was associated with less severe cardiac dysfunction measured a day earlier. However, after 10 days, WT and CrmA Tg mice showed similar degrees of DOX-induced cardiac dysfunction and correspondingly similar mortality. The survival benefit associated with cardiac-specific

H-00168-2010_R4/8 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 Delayed activation of AIF in CrmA Tg mice after DOX injection To determine the mechanisms that might contribute to mortality differences in WT and CrmA Tg mice after DOX injection, we harvested hearts at 5 days and 10 days for molecular, biochemical and histological analyses. To confirm that CrmA overexpression resulted in the inhibition of caspase activation, we measured the activities of caspase-3, caspase-8 and caspase-9 in heart lysates from WT and CrmA Tg mice after DOX and vehicle injection. We found that DOX induced significant activation of caspase-3, caspase-8 and caspase-9 activities in WT mice compared to vehicle at both 5 and 10 days (Figure 2A - 2C). In contrast, in CrmA Tg mouse heart, caspase-3, caspase-8 and caspase-9 activities were nearly completely inhibited at 5 and 10 days after DOX injection. We also confirmed caspase inhibition in CrmA Tg mouse hearts, by measuring the cleavage of ICAD (inhibitor of caspase-activated DNase). We found significant ICAD cleavage in WT mouse hearts after DOX injection. In contract, ICAD cleavage was completely attenuated both at 5 and 10 days after DOX injection in CrmA Tg mouse hearts (Figure 2D). Next, to determine if caspase inhibition in CrmA Tg mice inhibits cardiac apoptosis, we assessed cardiac apoptosis using TUNEL staining. Doxorubicin significantly increased TUNEL positive cardiomyocytes at both 5 and 10 days in both WT and CrmA Tg mice compared to vehicle injected mice (Figure 2E). However, there were significantly fewer TUNEL positive cells in CrmA Tg than WT mice 5 days after DOX injection. This early protection against apoptosis in the CrmA Tg group, however, was no longer evident 10 days after DOX injection, expression of the caspase inhibitor, CrmA, thus appears to be associated with the earlier, rather than the later, stages of DOX-induced cardiomyopathy.

H-00168-2010_R4/9 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 PARP-1 inhibition significantly improved mortality by inhibiting AIF-induced apoptosis We next sought to determine whether we could improve survival in DOX-induced cardiomyopathy by inhibiting AIF-induced apoptosis. PARP-1 has been shown to regulate AIF, including its translocation from the mitochondria to the nucleus (29, 40). To inhibit AIF, mice were thus treated daily with a potent inhibitor of PARP-1 activation, 4-AN, starting 1 day before DOX injection using the following groups: 1) WT+DOX+Vehicle, 2) WT+DOX+4-AN, 3) CrmA Tg+DOX+Vehicle, and 4) CrmA Tg+DOX+4-AN. We found that DOX significantly increased PARP-1 activity in both WT and Tg mice 10 days after injection, and, as expected, that 4-AN effectively reduced PARP-1 activation by DOX to the baseline level in both WT and suggesting that a significant increase in cardiac apoptosis occurred in response to DOX despite a complete inhibition of caspase (Figure 2E). Significant cardiac apoptosis in the absence of caspase activation in CrmA Tg heart raises the possibility of increased activity in alternative, caspase-independent apoptotic pathways. We therefore examined the activation of AIF-induced apoptosis. AIF translocation from mitochondria is an early hallmark of AIF activation. WT mice showed no significant increase in the release of AIF from mitochondria to the cytosol 5 days after DOX injection (Figure 3A and 3B). In contrast, a significant release of AIF in CrmA Tg mice at 5 days suggested an early activation of AIF. Ten days after DOX injection, there was significant release of AIF in both WT (p<0.05 vs vehicle) and CrmA Tg mice (p<0.05 vs vehicle and 5 day DOX) but AIF release in CrmA Tg was significantly greater at 64% than in WT mice. This finding suggests that an activation of AIF may play a role in the late stage of DOX-induced cardiomyopathy, and that this event may explain the loss of the early survival benefit conferred by caspase inhibition.

H-00168-2010_R4/10 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 CrmA Tg mice hearts (Figure 4A). Caspase-3 activity was not significantly inhibited by 4-AN alone (Figure 4B). Next, to determine whether pre-treatment with 4-AN attenuates AIF-induced apoptosis, we examined AIF translocation from the mitochondria to the cytosol. We found that 4-AN significantly blocked DOX-induced AIF translocation in both WT and CrmA Tg mouse hearts (Figure 4C 4D). We also observed significant AIF translocation to the nucleus after DOX injection in both WT and CrmA Tg mouse hearts, which were blocked by 4-AN (Figure 4E). These findings suggest that PARP-1 inhibition effectively blocks DOX-induced PARP-1 activation as well as AIF translocation. We next examined the question of whether inhibiting AIF translocation via PARP-1 inhibition affects the rate of DOX-induced cardiac apoptosis. Vehicle treatment was associated with very low levels of baseline cardiac apoptosis (<0.1%) in both WT and CrmA Tg mice hearts (Figure 5A and 5B). Ten days after DOX injection, the number of TUNEL positive cardiomyocytes was significantly increased in both WT and Crma Tg groups, but the increase was significantly smaller after 4-AN treatment in both WT (6.8 1.6%) and CrmA Tg (5.6 1.0%) compared to untreated hearts. Consistent with these results, we also found that treatment with 4-AN significantly mitigated the DOX-induced impairment of cardiac function in both groups (Table 1). PARP-1 inhibitor alone did not exert any significant effect on hemodynamic parameters in vehicle mice. These findings suggest that the attenuation of AIF activation by PARP inhibition significantly reduced cardiac apoptosis and improved cardiac function in DOXinduced cardiomyopathy. Finally, to determine if the inhibition of AIF induced apoptosis by 4-AN translates into improved survival in mice treated with DOX, we determined survival rates for both WT and CrmA Tg mice after DOX injection with or without 4-AN. In this experiment, there were 55%

H-00168-2010_R4/11 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 Discussion In this study, we showed a significant activation of caspase-independent apoptosis in DOX-induced cardiomyopathy in Tg mice with cardiac-specific caspase inhibition via overexpression of CrmA. CrmA Tg mice showed an initial survival benefit associated with the inhibition of caspase activation in response to DOX-induced acute heart failure compared to WT littermates. However, there was a delayed but significant activation of AIF-induced, caspaseindependent apoptosis, and the overall mortality rate was ultimately similar to wild-type mice. Treatment with 4-AN, a potent PARP inhibitor, significantly decreased AIF-induced apoptosis, improved cardiac function, and increased survival in both CrmA Tg and WT mice compared to those without 4-AN after DOX injection. We conclude that caspase-dependent apoptosis plays an important role in WT mice at 5 days, since there was both a significant increase in apoptosis and activation of caspases, in comparison to CrmA Tg mice, which showed no significant apoptosis at 5 days and no caspase activation. Nevertheless, caspase-independent apoptosis likely contributes significantly to DOX-induced cardiomyopathy even in WT mice, since treatment with 4-AN, a potent PARP inhibitor, significantly decreased AIF-induced apoptosis, improved cardiac dysfunction, and increased survival in both CrmA Tg and WT mice compared and 75% survival rate 6 days after DOX injection, and 18% and 13% survival rate 12 days after DOX injection in WT and CrmA Tg mice, respectively. We found that pretreatment with 4-AN significantly improved survival in both WT (89 % vs. 18 %) and CrmA Tg (93% vs. 13%) mice compared to those without 4-AN 12 days after DOX injection (Figure 6). Both WT and CrmA Tg mice showed a significant benefit, suggesting that the inhibition of AIF activation by 4-AN may play an essential role in protecting against DOX-induced cardiac dysfunction.

H-00168-2010_R4/12 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 to those without 4-AN after DOX injection. These novel findings suggest the potentially significant role of caspase-independent apoptosis in the development of heart failure in this model. Caspase inhibition has been shown to reduce the acute loss of myocardium in various animal models (17, 38). However, other studies indicate that caspase inhibition alone might not be sufficient to eliminate apoptosis completely (25). Several studies have shown that even in the presence of complete caspase inhibition, such as pharmacological caspase inhibition by zVAD.fmk, nuclear DNA fragmentation was present, and significant tissue damage still observed (12, 40). It thus appears that caspase-independent pathways, such as those mediated by PARP-1/AIF, may play an important role in the induction of apoptosis, and contribute significantly to apoptotic cell death in heart. In this study, we showed that caspase inhibition using CrmA successfully blocked caspase-3, -8 and -9 activation in CrmA Tg mice after DOX exposure suggesting that this is an effective strategy for inhibiting caspase activation in a cardiac-specific manner in vivo. However, the initial improvement in survival was followed by a delayed but exaggerated increase in mortality, which negated the initial benefit of caspase inhibition by CrmA overexpression. AIF and cytochrome c are important for cell viability when they are located in mitochondria, but when released from mitochondria, they both activate apoptotic programs. Our current findings suggest, however, that caspase-dependent and caspase-independent apoptosis have different and distinct time courses. Although we observed an initial survival benefit after 6 days in response to acute heart failure induced by DOX in CrmA Tg mice compared to WT littermates, by 12 days after DOX injection the CrmA Tg survival rate had fallen to the WT level, and the overall mortality rate was ultimately similar to that of wild-type mice. In addition,

H-00168-2010_R4/13 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 at 10 days after DOX injection, there was a significant release of AIF in both WT and CrmA Tg heart without a change in total AIF. These findings also support the notion that in the setting of caspase inhibition, caspase-independent apoptosis, such as AIF-induced apoptosis, is activated. Indeed, numerous studies have reported that mitochondrial release of AIF takes place downstream of cytochrome c release, and is further enhanced in the setting of caspase inhibition (2, 21, 35). PARP-1 is a highly conserved, 116-kDa nuclear enzyme involved in DNA repair (29, 40) that has been shown to facilitate both the release of AIF from mitochondria and AIF nuclear translocation (1, 13, 29, 40). After translocating to the nucleus, AIF mediates large-scale DNA fragmentations by enhancing the activity of endonuclasese G (Endo G) (21, 36). In the present studies, we demonstrated that PARP-1 inhibition significantly attenuates the DOX-induced AIF release from mitochondria in both WT and CrmA Tg mice. This result further supports the idea that PARP-1 activation is most likely the main mechanism of AIF activation and AIF may be an essential downstream effector in the cell death program initiated by PARP-1. In fact, PARP1/AIF activation may also play an important role in the induction of apoptosis in WT mice with DOX-induced heart failure. Since apoptosis is a highly orchestrated process involving multiple pathways, we cant exclude the possibility that PARP-1 inhibition may be involved in caspasedependent as well as caspase-independent pathways. Other investigators have shown that in a murine model of heart failure, PARP inhibition attenuates the development of hypertrophy and the mitochondrial-to-nuclear translocation of AIF. Molnar et al has demonstrated an activation of PARP-1 in the failing heart by showing an increased abundance of poly-ADP ribosylated proteins (22). In a mouse model of heart failure induced by transverse aortic banding, the extent of AIFs mitochondrial-to-nuclear translocation was reduced by the inhibition of PARP-1

H-00168-2010_R4/14 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 activation, through the use of either isoindolinone-based PARP inhibitor (INO-1001) or PARP-1 genetic deficient mice (37). The mechanism responsible for PARP-1-dependent release of AIF from mitochondria remains to be identified, but it has been proposed that the cell death pathway initiated by PARP-1 activation may be mediated by AIF (40). In the present study, we used a well-established mouse model of DOX-induced acute heart failure that shows a good correlation between the degree of myocardial apoptosis and the severity of DOX-induced heart failure (24). DOX-induced cardiomyopathy was chosen to test our hypothesis in an in vivo animal model of cardiac apoptosis during the progression of heart failure because apoptotic cell death is a key component in DOX-induced cardiotoxicity (26, 31). Although death associated with the administration of DOX in experimental animals may be multifactorial, cardiomyopathy is the most important cause of mortality after DOX injection (26, 39). Our results suggest that by inhibiting apoptosis, we may be able to significantly improve cardiac function and mortality in this model. Studies suggest that DOX induces caspaseindependent as well as caspase-dependent apoptosis, and showed that apoptosis is initiated via both caspase-3 activation and AIF nuclear translocation by mitochondrial damage after DOX exposure (33, 39). While further studies are needed to determine whether caspase-independent apoptosis plays a significant role in other models of cardiomyopathy, such as myocardial infarction, current studies suggest that the caspase independent apoptotic route is also involved in the death of cardiomyocytes by DOX. While the inhibition of apoptosis promises to be an important target for therapeutic intervention, better defining the significance of specific apoptotic mechanisms will be critical in understanding how the myocardium is lost during heart failure. Our findings provide further clarification of the role of caspase-independent apoptosis in the heart, and contribute

H-00168-2010_R4/15 325 326 to a better understanding of the molecular mechanisms that are involved in AIF-induced cardiac apoptosis.

H-00168-2010_R4/16 327 328 329 330 Acknowledgments This study was supported in part by the grants from National Institutes of Health RO1 HL091998 (PMK).

H-00168-2010_R4/17 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 References 1. Alonso M, Tamasdan C, Miller DC, Newcomb EW. Flavopiridol induces apoptosis in

glioma cell lines independent of retinoblastoma and p53 tumor suppressor pathway alterations by a caspase-independent pathway. Mol Cancer Ther 2: 139-150, 2003. 2. Arnoult D, Parone P, Martinou JC, Antonsson B, Estaquier J, Ameisen JC.

Mitochondrial release of apoptosis-inducing factor occurs downstream of cytochrome c release in response to several proapoptotic stimuli. J Cell Biol 159: 923-929, 2002. 3. Bae S, Yalamarti B, Kang PM. Role of caspase-independent apoptosis in cardiovascular

diseases. Front Biosci 13: 2495-2503, 2008. 4. Bahi N, Zhang J, Llovera M, Ballester M, Comella JX, Sanchis D. Switch from

caspase-dependent to caspase-independent death during heart development: essential role of endonuclease G in ischemia-induced DNA processing of differentiated cardiomyocytes. J Biol Chem 281: 22943-22952, 2006. 5. Cande C, Cecconi F, Dessen P, Kroemer G. Apoptosis-inducing factor (AIF): key to

the conserved caspase-independent pathways of cell death? J Cell Sci 115: 4727-4734, 2002. 6. Chen M, Zsengeller Z, Xiao CY, Szabo C. Mitochondrial-to-nuclear translocation of

apoptosis-inducing factor in cardiac myocytes during oxidant stress: potential role of poly(ADPribose) polymerase-1. Cardiovasc Res 63: 682-688, 2004. 7. Choudhury S, Bae S, Kumar SR, Ke Q, Yalamarti B, Choi JH, Kirshenbaum LA,

Kang PM. Role of AIF in cardiac apoptosis in hypertrophic cardiomyocytes from Dahl saltsensitive rats. Cardiovasc Res 85: 28-37, 2010. 8. Cregan SP, Dawson VL, Slack RS. Role of AIF in caspase-dependent and caspase-

independent cell death. Oncogene 23: 2785-2796, 2004.

H-00168-2010_R4/18 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 9. Cregan SP, Fortin A, MacLaurin JG, Callaghan SM, Cecconi F, Yu SW, Dawson

TM, Dawson VL, Park DS, Kroemer G, Slack RS. Apoptosis-inducing factor is involved in the regulation of caspase-independent neuronal cell death. J Cell Biol 158: 507-517, 2002. 10. Gurevich RM, Regula KM, Kirshenbaum LA. Serpin protein CrmA suppresses

hypoxia-mediated apoptosis of ventricular myocytes. Circulation 103: 1984-1991, 2001. 11. Han Y, Chen YS, Liu Z, Bodyak N, Rigor D, Bisping E, Pu WT, Kang PM.

Overexpression of HAX-1 protects cardiac myocytes from apoptosis through caspase-9 inhibition. Circ Res 99: 415-423, 2006. 12. Hong SJ, Dawson TM, Dawson VL. Nuclear and mitochondrial conversations in cell

death: PARP-1 and AIF signaling. Trends Pharmacol Sci 25: 259-264, 2004. 13. Joseph B, Marchetti P, Formstecher P, Kroemer G, Lewensohn R, Zhivotovsky B.

Mitochondrial dysfunction is an essential step for killing of non-small cell lung carcinomas resistant to conventional treatment. Oncogene 21: 65-77, 2002. 14. Kang PM, Haunstetter A, Aoki H, Usheva A, Izumo S. Morphological and molecular

characterization of adult cardiomyocyte apoptosis during hypoxia and reoxygenation. Circ Res 87: 118-125, 2000. 15. Kang PM, Izumo S. Apoptosis in heart: basic mechanisms and implications in

cardiovascular diseases. Trends Mol Med 9: 177-182, 2003. 16. Lakhani SA, Masud A, Kuida K, Porter GA, Jr., Booth CJ, Mehal WZ, Inayat I,

Flavell RA. Caspases 3 and 7: key mediators of mitochondrial events of apoptosis. Science 311: 847-851, 2006.

H-00168-2010_R4/19 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 17. Laugwitz KL, Moretti A, Weig HJ, Gillitzer A, Pinkernell K, Ott T, Pragst I,

Stadele C, Seyfarth M, Schomig A, Ungerer M. Blocking caspase-activated apoptosis improves contractility in failing myocardium. Hum Gene Ther 12: 2051-2063, 2001. 18. Li L, Takemura G, Li Y, Miyata S, Esaki M, Okada H, Kanamori H, Khai NC,

Maruyama R, Ogino A, Minatoguchi S, Fujiwara T, Fujiwara H. Preventive effect of erythropoietin on cardiac dysfunction in doxorubicin-induced cardiomyopathy. Circulation 113: 535-543, 2006. 19. Logue SE, Gustafsson AB, Samali A, Gottlieb RA. Ischemia/reperfusion injury at the

intersection with cell death. J Mol Cell Cardiol 38: 21-33, 2005. 20. Lorenzo HK, Susin SA, Penninger J, Kroemer G. Apoptosis inducing factor (AIF): a

phylogenetically old, caspase-independent effector of cell death. Cell Death Differ 6: 516-524, 1999. 21. Modjtahedi N, Giordanetto F, Madeo F, Kroemer G. Apoptosis-inducing factor: vital

and lethal. Trends Cell Biol 16: 264-272, 2006. 22. Molnar A, Toth A, Bagi Z, Papp Z, Edes I, Vaszily M, Galajda Z, Papp JG, Varro A,

Szuts V, Lacza Z, Gero D, Szabo C. Activation of the poly(ADP-ribose) polymerase pathway in human heart failure. Mol Med 12: 143-152, 2006. 23. Mukhopadhyay P, Batkai S, Rajesh M, Czifra N, Harvey-White J, Hasko G,

Zsengeller Z, Gerard NP, Liaudet L, Kunos G, Pacher P. Pharmacological inhibition of CB1 cannabinoid receptor protects against doxorubicin-induced cardiotoxicity. J Am Coll Cardiol 50: 528-536, 2007. 24. Neilan TG, Blake SL, Ichinose F, Raher MJ, Buys ES, Jassal DS, Furutani E, Perez-

Sanz TM, Graveline A, Janssens SP, Picard MH, Scherrer-Crosbie M, Bloch KD.

H-00168-2010_R4/20 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 Disruption of nitric oxide synthase 3 protects against the cardiac injury, dysfunction, and mortality induced by doxorubicin. Circulation 116: 506-514, 2007. 25. Okamura T, Miura T, Takemura G, Fujiwara H, Iwamoto H, Kawamura S,

Kimura M, Ikeda Y, Iwatate M, Matsuzaki M. Effect of caspase inhibitors on myocardial infarct size and myocyte DNA fragmentation in the ischemia-reperfused rat heart. Cardiovasc Res 45: 642-650, 2000. 26. Pacher P, Liaudet L, Bai P, Virag L, Mabley JG, Hasko G, Szabo C. Activation of

poly(ADP-ribose) polymerase contributes to development of doxorubicin-induced heart failure. J Pharmacol Exp Ther 300: 862-867, 2002. 27. Pacher P, Nagayama T, Mukhopadhyay P, Batkai S, Kass DA. Measurement of

cardiac function using pressure-volume conductance catheter technique in mice and rats. Nat Protoc 3: 1422-1434, 2008. 28. Penninger JM, Kroemer G. Mitochondria, AIF and caspases--rivaling for cell death

execution. Nat Cell Biol 5: 97-99, 2003. 29. Pieper AA, Brat DJ, Krug DK, Watkins CC, Gupta A, Blackshaw S, Verma A,

Wang ZQ, Snyder SH. Poly(ADP-ribose) polymerase-deficient mice are protected from streptozotocin-induced diabetes. Proc Natl Acad Sci U S A 96: 3059-3064, 1999. 30. Ray CA, Black RA, Kronheim SR, Greenstreet TA, Sleath PR, Salvesen GS, Pickup

DJ. Viral inhibition of inflammation: cowpox virus encodes an inhibitor of the interleukin-1 beta converting enzyme. Cell 69: 597-604, 1992. 31. Singal PK, Iliskovic N. Doxorubicin-induced cardiomyopathy. N Engl J Med 339: 900-

905, 1998.

H-00168-2010_R4/21 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 32. Siu PM, Bae S, Bodyak N, Rigor DL, Kang PM. Response of caspase-independent

apoptotic factors to high salt diet-induced heart failure. J Mol Cell Cardiol 42: 678-686, 2007. 33. Suliman HB, Carraway MS, Ali AS, Reynolds CM, Welty-Wolf KE, Piantadosi CA.

The CO/HO system reverses inhibition of mitochondrial biogenesis and prevents murine doxorubicin cardiomyopathy. J Clin Invest 117: 3730-3741, 2007. 34. Susin SA, Lorenzo HK, Zamzami N, Marzo I, Snow BE, Brothers GM, Mangion J,

Jacotot E, Costantini P, Loeffler M, Larochette N, Goodlett DR, Aebersold R, Siderovski DP, Penninger JM, Kroemer G. Molecular characterization of mitochondrial apoptosisinducing factor. Nature 397: 441-446, 1999. 35. Uren RT, Dewson G, Bonzon C, Lithgow T, Newmeyer DD, Kluck RM.

Mitochondrial release of pro-apoptotic proteins: electrostatic interactions can hold cytochrome c but not Smac/DIABLO to mitochondrial membranes. J Biol Chem 280: 2266-2274, 2005. 36. Wang X, Yang C, Chai J, Shi Y, Xue D. Mechanisms of AIF-mediated apoptotic DNA

degradation in Caenorhabditis elegans. Science 298: 1587-1592, 2002. 37. Xiao CY, Chen M, Zsengeller Z, Li H, Kiss L, Kollai M, Szabo C. Poly(ADP-Ribose)

polymerase promotes cardiac remodeling, contractile failure, and translocation of apoptosisinducing factor in a murine experimental model of aortic banding and heart failure. J Pharmacol Exp Ther 312: 891-898, 2005. 38. Yaoita H, Ogawa K, Maehara K, Maruyama Y. Attenuation of ischemia/reperfusion

injury in rats by a caspase inhibitor. Circulation 97: 276-281, 1998. 39. Youn HJ, Kim HS, Jeon MH, Lee JH, Seo YJ, Lee YJ, Lee JH. Induction of caspase-

independent apoptosis in H9c2 cardiomyocytes by adriamycin treatment. Mol Cell Biochem 270: 13-19, 2005.

H-00168-2010_R4/22 443 444 445 446 447 448 449 450 40. Yu SW, Wang H, Poitras MF, Coombs C, Bowers WJ, Federoff HJ, Poirier GG,

Dawson TM, Dawson VL. Mediation of poly(ADP-ribose) polymerase-1-dependent cell death by apoptosis-inducing factor. Science 297: 259-263, 2002. 41. Zhou Q, Snipas S, Orth K, Muzio M, Dixit VM, Salvesen GS. Target protease

specificity of the viral serpin CrmA. Analysis of five caspases. J Biol Chem 272: 7797-7800, 1997.

H-00168-2010_R4/23 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 Figure 2. Caspase inhibition in DOX-induced cardiomyopathy in WT and CrmA Tg mice. A - C. Caspase-3-like (A), caspase-8-like (B), and caspase-9-like (C) activities in WT and CrmA Tg mice 5 and 10 days after DOX injection. Veh: Vehicle, DOX: 5 and 10 days after DOX injection. * P < 0.05, NS=not significant. (n=5-7/group) D. Representative Western immunoblots of ICAD of WT and CrmA Tg mice 5 (D5) and 10 (D10) days after DOX injection. V=Vehicle injected control at 10 days. GADPH is the internal loading control. E. TUNEL staining in WT and CrmA Tg mice 5 and 10 days after DOX injection. * P < 0.05, NS=not significant. (n = 5-7/group). Figure Legends Figure 1. Generation of CrmA Tg mice and survival of DOX-induced cardiomyopathy in WT and CrmA Tg mice. A. Schematic diagram of the construct used to generate Tg mice with cardiac specific overexpression of CrmA. Cardiac specific expression was achieved using MHC promoter. B. Genotyping of CrmA Tg mice. CrmA transgenic mice were identified by the appearance of a 525-bp band in tail genomic DNA. C. Representative Western immunoblot analysis of different tissues from CrmA Tg mouse. GAPDH was used as an internal control. D. Representative Western immunoblot analysis of heart tissues from WT and CrmA Tg mice hearts. E. Twelve day survival curves for WT and CrmA Tg mice after DOX (20 mg/kg) or vehicle injection. n=6/group (vehicle) and 21/group (DOX). The early term survival of WT/DOX mice was significantly less than CrmA/DOX mice (at day 6, P <0.05 by Wilcoxons test) but the DOX groups did not differ at day 12.

H-00168-2010_R4/24 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 Figure 5. TUNEL staining of WT and CrmA Tg mice 10 days after DOX injection with or without 4-AN. A. Representative images of TUNEL staining in WT and CrmA Tg mice with or without 4-AN. TUNEL= green, Nuclei= blue, -Actinin = red, Magnification: 60x. B. Quantification of TUNEL staining. *P<0.05. (n=6-8) Figure 4. The effect of PARP inhibition on AIF release 10 days after DOX injection with or without 4-AN. A. PARP activity assay in WT and CrmA Tg mice 10 days after DOX injection. * P < 0.05. (n = 4). B. Caspase-3-like activities assay in WT and CrmA Tg mice 10 days after DOX injection. * P < 0.05, NS=not significant. (n = 4). C. Representative Western immunoblots of AIF in the mitochondria-free, cytosolic fraction of WT or CrmA heart after vehicle, DOX or DOX plus 4-AN administration. GAPDH was used as an internal control. The two rightmost columns of blots represented the DOX+4-AN conditions for the WT and CrmA groups. D. Quantification of cytosolic protein content of AIF. *P < 0.05. (n =4). E. AIF Immunofluorescent staining of WT and CrmA Tg mice 5 days after DOX injection with or without 4-AN. AIF= green, Nuclei= blue, -Actinin = red, Magnification: 60x. Figure 3. AIF release in DOX-induced cardiomyopathy in WT and CrmA Tg mice. A. Representative Western immunoblots of AIF in the mitochondria-free cytosolic fraction and total AIF in WT and CrmA Tg mice 5 and 10 days after DOX injection. Individual representative images are identified by a line between images. The purity of the cytosolic proteins was examined by immunoblots of (cytosolic specific) GAPDH and (mitochondrial specific) COX IV. B. Quantification of cytosolic protein content of AIF. * P < 0.05, NS=not significant. (n = 4).

H-00168-2010_R4/25 497 498 499 500 501 Figure 6. Survival graph of WT and CrmA Tg mice with 4-AN (3mg/kg) administration after DOX injection. Survival was monitored for up to 12 days. *P<0.05. (n=6/vehicle groups, 10-18/DOX groups)

A.
hGH polyA (0.6Kb) MHC promotor (5.5kb) P E CrmA (1.4Kb) E E E P

B.

500 bp

CrmA

C.
heart lung liver kidney

D.
WT

Hearts
CrmA Tg

CrmA GAPDH

CrmA C A GAPDH

E.

100

WT+Veh CrmA+Veh WT+DOX CrmA+DOX

Survivial Rate (%)

80 60 40 20 0

P<0.05 (Day 6)
0 1 2 3 4 5 6 7 8 9 10 11 12

P=NS (Day 12)

Days after injection

Figure 1

A.
Ca aspase-3-like Activ vity (Arbitary Units)
25 20 15 10 5 0

B.
Ca aspase-8-like Activ vity (Arbitary Units)

C.
25 20 15 10 5 0

10 days

Ca aspase-9-like activ vity (Arbitary Unit)

5 days 10 days

* *

5 days

20

15

5 days 10 days

NS

NS

NS

NS

10

NS

NS

Veh Dox Veh Dox

Veh Dox Veh Dox

Veh Dox Veh Dox

Veh Dox Veh Dox

Veh Dox Veh Dox

Veh Dox Veh Dox

WT

CrmA

WT

CrmA

WT

CrmA

D.
WT
V D5 D10 V

E.
TU UNEL + Cardiomyo ocytes (%)

5 days
40 30 20 10 0
Veh DOX

10 days
p=NS

CrmA Tg
D5 D10

* * *
Veh DOX Veh

ICAD Cleaved form GAPDH

DOX

Veh DOX

WT

CrmA

WT

CrmA

Figure 2

A.
0 day
AIF (Cytosol) AIF (Total) GAPDH CP COXIV

WT
5 days 10 days 0 day

CrmA
5 days 10 days

CP

CP

CP

CP

CP

B.
A AIF Release (AIF cy ytosol/AIF total)

0 day
1.00 1 00 0.75 0.50 0.25 0.00

5 days

10 days

*
NS

WT

CrmA

Figure 3

Caspas se-3-like Activity y (Ar rbitary Unit)

A.
3

Vehicle

DOX

DOX+4-AN

B.

20

Vehicle

Dox

Dox+4-AN
NS NS

PAR Activity RP (Fold of Vehicle) o

NS

10

WT

CrmA

WT
Vehicle
4

CrmA
DOX DOX+4-AN

C.
Veh

WT
DOX DOX DOX +4-AN +4-AN Veh

CrmA
DOX DOX DOX +4-AN +4-AN

D.

AIF (cytosol) AIF (total) GAPDH

AIF release (Fold of Vehicle e)

3 2 1 0

WT

CrmA

Figure 4, A-D

E. E

Sham

DOX

DOX+4-AN

WT

CrmA Tg

Figure 4, E 4

A. A

Vehicle

DOX

DOX+4-AN

WT

CrmA

B.
TUNEL + Cardiomyocyte es (%)
40

Vehicle

DOX

DOX+4-AN

30

20

10

WT

CrmA

Figure 5

100

WT Veh+4-AN CrmA Veh+4-AN WT:DOX CrmA:DOX WT:DOX+4-AN CrmA:DOX+4-AN

Survival Rate (%) e

80 60 40 20 0 0 1 2 3 4 5 6 7 8 9 10 11 12

* *
Days after injection

Figure 6

Table 1. LV hemodynamic 5 days after DOX injection in WT and CrmA Tg mice

Genotype LVEDP, mmHg WT CrmA LVSP, mmHg WT CrmA dP/dtmax, mmHg/s WT CrmA dP/dtmin, mmHg/s WT CrmA SW, mmHgxl WT CrmA CO, ml/min WT CrmA

Vehicle 3.60.8 3.70.2 111.52.6 111.22.1 9055234 9043339 7415467 7238564 127963.0 126481.9 5.10.4 5.30.4

DOX 5.00.5 3.80.4 94.31.8* 101.83.4 6258302 * 8815355 5152229* 7159218 849112.5 * 116488.5 3.30.4* 4.50.3

LVEDP, left ventricular end diastolic pressure; LVSP, left ventricular systolic pressure, dP/dtmax and dP/dtmin, maximum and minimum first derivative of ventricular pressure with respect to time; SW, stroke work; CO. cardiac output. * P<0.05 (DOX vs Veh), P<0.05 (DOX WT vs DOX CrmA). N=5-6.

Table 2. LV hemodynamic 10 days after DOX injection in WT and CrmA Tg mice

Genotype LVEDP, mmHg WT CrmA LVSP, mmHg WT CrmA dP/dtmax, mmHg/s WT CrmA dP/dtmin, mmHg/s WT CrmA CO, ml/min WT CrmA Tau, msec WT CrmA

Vehicle 3.51.1 3.10.3 107.92.2 111.83.2 8693304 8896486 7282530 6945562 5.00.4 5.20.5 12.41.1 11.50.7

DOX 7.10.8 * 7.10.6 * 91.245.7* 82.32.6* 6529715*

DOX+4-AN 4.20.5 3.30.5 103.43.8 105.26.6 8102461

58161075* 8413265 4202480* 3029548* 2.80.2* 2.30.1* 23.04.0* 24.82.3* 6914246 6026359 4.80.4 4.40.6 13.61.2 14.01.2

LVEDP, left ventricular end diastolic pressure; LVSP, LV systolic pressure, dP/dtmax and dP/dtmin, maximum and minimum first derivative of ventricular pressure with respect to time; SW, stroke work; CO, cardiac output; Tau, ventricular isovolumic relaxation time constant. * P<0.05 (DOX vs Veh), P<0.05 (DOX vs DOX+4-AN). n=6-7.