Introduction : Gene cloning involves the process of transferring gene of interest from one organism into a bacterial plasmid.

The bacterial plasmid is a self-replicating organism which can replicate itself as well as the newly inserted gene of interest in a short time. Due to the effectiveness of this technique, scientists often use it to make multiple copies of the same gene of interest so that it is enough for further research.

Figure 1. Gene cloning process.

Before scientists proceed to cloning a gene, they will plan a cloning experiment by using ApE software. ApE is an acronym for A plasmid Editor. In this practical, I was taught on how to use ApE for the purpose of planning to clone Bacillus subtilis amylase gene into pUC19 plasmid vector. At initial, the ApE requires the user to retrieve the sequence of vector and the gene of interest (to be cloned). The information is retrieved at http://www.neb.com and

http://www.ncbi.com. The information is important in order to design a PCR amplification product. The components of PCR product are forward and reverse primers, the ATA sequence and restriction enzymes at the start and ends of the DNA fragment, 6xHis and stop codon. All of these components are planned by using ApE. One of the features in the ApE is Enzyme Selector. It contains information about restriction enzymes available and number of cut sites. This feature helps the user to choose the correct restriction enzyme for correct ligation process. Other features are Find Primers and Graphic Map. Find Primers helps the user to find forward and reverse primers according to a specified criteria (%GC~50, Tm~55 and length>20). Graphic Map gives overview of cloned gene (in theory). The image viewed is the sequences or components which are constructed in the DNA windows.2 To conclude this, ApE software helps scientists all over the world to plan a cloning experiment in virtual manner before they proceed to hands on experiment.

Objective

1) To use ApE to plan a cloning experiment. 2) To learn how to plan and conduct a cloning experiment.

Results

Figure 2. pUC19 vector.

Primer Forward Reverse

Sequence gatgtgacagcgtctaactatgg ccgctccagctttattgtcatac

Length 23 23

%GC 47 47

Tm 56 57

Coordinates 796... 818 1324...1302

Table 1. Forward and reverse primer sequence information.

Figure 3. Reverse pUC19 vector

Figure 4 (a). Text Map of PCR product of Amylase gene.

Figure 4 (b). Text Map of PCR product of Amylase gene.

Figure 4 (c). Text Map of PCR product of Amylase gene.

Reverse primer ATA HindIII 6x His Forward primer Amylase gene

ATA

EcoRI

Stop codon
Figure 5. PCR product of Amylase gene.

Figure 6. pUC19 vector + Bacillus subtilis amylase gene

References

1) Figure 1. Gene cloning process. Retrieved at http://www.ornl.gov/sci/techresources/Human_Genome/publicat/primer/fig11a.htm 2) A plasmid Editor, Davis M. Dwayne, 2003,2004. Retrieved at http://www.my-pharm.ac.jp/~khigashi/higashi/hide/ApE%20documentation.pdf