Name __Casey Hindon____

OCR Gateway GCSE Additional Science B3: Living and growing

Molecules of life

DNA code DNA is a chemical found inside the nucleus. It forms structures called chromosomes. A section of a chromosome is called a gene. Each gene is a code for making proteins. Our bodies need to make proteins to grow and repair cells. Everyone has his or her own unique DNA code. Question: Why does a cell need to make proteins? The cell needs protein as Protein provides growth and repair for the cell/organism. Mitochondria Cell respiration is carried out inside mitochondria. During respiration energy is released from glucose in the presence of oxygen. DNA

Question: Complete the text using the words that follow: DNA consists of two long molecules called polynucleotides wrapped around each other. Each polynucleotide strand is made up of small molecules joined together called bases. Each nucleotide has a sticky part to it called a nucleotide base. Bases of two different nucleotides can bond to each other and this is how the two polynucleotide strand hold together. Purine type of base bond to Pyridimine type of base Purine bases are adenine (A) and guanine (G) Pyrimidine bases are thymine (T) and cytosine (C) Possible words: Pyrimidine, nucleotide, base, Question: On the previous diagram, colour the purine bases in red and the pyrimidine bases in blue. Label them on your diagram. DNA controls which amino acids are linked together to form proteins. They also therefore control which proteins are made in a cell and therefore its features. The structure of DNA helps it to copy itself every time a cell divides. When DNA makes a copy it is called DNA replication.

In 1985, scientist Alex Jeffreys developed a way of using DNA to identify people called DNA fingerprinting. The process produces a pattern of bands, like a barcode, which is unique. 3

Question: Suggest one reason why muscle cells have a lot of mitochondria. Muscle cells have a lot of mitochondria so plenty of respiration can take place can take place providing the cell with plenty of energy. Question: From where does the body get its supply of amino acids? Either from meat or fish (Essential proteins ones the body cannot make) or it produces them in the liver. Question: Explain how DNA can be used to catch a thief. DNA fingerprinting can be used to compare the DNA from the suspects with the DNA found at the crime scene. Question: What is a gene and what does it code for? A gene is the chemical compound which makes up a person. They are found in the nucleus made up of DNA and the chromosomes. DNA replication Question: Complete the following text using the words that follow: 4

When DNA replicates, the two polynucleotide strands unwrap. This exposes strands of the nucleotides. Floating about in the nucleus are free nucleotides. The bases of these free floating nucleotides bonds to the exposed bases on the two strands. Complementary bases pairing occurs, guanine bonds to cytosine and adenine bonds to thymine. A new polynucleotide strand is formed around each of the original strands which wraps around them forming two double helical DNA molecules. Possible words: wrap, cytosine, thymine, unwrap, bases, nucleotides, strands

Protein synthesis The order of bases in a section of DNA is called the base code. Each three bases code for an amino acid. For example the sequence CAA codes for an amino acid called valine. Cells use these base codes to join amino acids together in the correct order. If an amino acid is missing from the diet, the liver can change other amino acids into those that are needed. Question: The body needs 20 different amino acids to make proteins. Explain why we do not need to eat all 20. The liver also produces some amino acids which means that we do not need to eat all of the 20 required amino acids. Question: How many amino acids are coding for the following section of DNA? AAATATCTCCCCTCAACCGGGCGGTAAATG Three bases make up one amino acid, there are 30 bases which would therefore make 10 amino acids. 5

Question: Write down the complementary base sequence for the section of DNA shown in the previous question. TTTATAGAGGGGAGTTGGCCCGCCATTTAC Making cheese When making cheese from milk. First milk is allowed to turn sour using an enzyme called rennin. Rennin is an enzyme. The milk separates into a solid called curd and a liquid called whey. The curds are then turned into cheese. Did you know? Clothes washing detergents use enzymes to speed up the break down of stains. Lipase enzymes break down fat stains. Protease enzymes break down protein stains. An enzyme is a biological catalyst. It is a protein that speeds up a biological reaction. Enzymes catalyse most chemical reactions occurring within cells, such as respiration, photosynthesis and protein synthesis. Each enzyme is specific to a substrate. In an enzyme-catalysed reaction, substrate molecules are changed into product molecules.

The effect of temperature on the rate of an enzyme controlled reaction The graph below shows how the rate of a typical enzyme catalysed reaction varies with temperature.

Question: Match up the half sentences appropriately. The first has been done for you

Stage 1: label this stage on your graph (1) At low temperature molecules are moving relatively slowly

(2) This is because the billions of (3) Substrate molecules will not often collide with the active site Stage 2: label this stage on your graph (4) As temperature rises, (5) Collisions happen more frequently (6) Moreover, when they do collide, they do so (7) This makes it easier for the bonds to be broken

the reaction takes place only slowly and so binding between substrate and enzyme is a rare event

the enzyme and substrate molecules bind faster so that the reaction can occur

so substrate molecules enter the active site more often. with more energy

Stage 3: label this on your graph after completing the text below. As temperature continues to increase, the speed of movement of the substrate and enzyme molecules also continues to increase. However, the enzyme molecule is also vibrating more and more energetically. Above a certain temperature called the optimum temperature, bonds between R groups of amino acids holding together the tertiary structure of the active site, begin to break down. The first of these bonds to break are the hydrogen bonds. As this continues, substrate molecules bind into the active site and form product less efficiently. Eventually, a point will be reached when the enzyme-substrate complex can no longer be formed because of the extremely deformed nature of the active site. The enzyme is then said to be denatured. (label this on the graph on page 12). An enzyme catalyses a reaction at a maximum rate when at the optimum temperature. Most human enzymes have an optimum temperature of about 40 degrees Celsius. Homeostatic mechanisms within our bodies try to ensure that our body temperature does not exceed this temperature. Enzymes from other organisms may have different optimum temperatures. Some enzymes, such as those found in bacteria which live in hot springs, have much higher optimum temperatures. Some plant enzymes have lower optimum temperatures, depending on their habitat. The optimum temperature of enzymes in an organism therefore limit where it can live on this planet. Possible words: energetically, denatured, temperature, bacteria, breakdown, plant Questions 7

(a) A boy has a very high fever. How might this be dangerous? If he has a very high temperature, it is a sign of an infection which could be passed on to other people. (b) How would a protease remove a bloodstain on clothes? Protease is an enzyme which digests proteins and since blood is mainly made out of proteins, the stain should be easily removed. Most biological washing powders are recommended for use at low washing temperatures. Why is this? The enzymes may work best in those particular conditions due to their own optimum temperature. (d) Washing powder manufacturers have produced proteases that can work at higher temperatures than 40 degrees Celsius. Where do these enzymes come from and why is this useful? These enzymes may have been engineered to work at a particular temperature eg. 40 degrees Celsius. These would be useful so that you would not have to specify a temperature in the wash. pH and enzyme activity Most enzymes work fastest at pH of somewhere around 7 i.e. fairly neutral conditions. Questions: Which enzyme works fastest in acidic conditions? The enzyme in your stomach. Optimum pH

Denaturing pH

The graph above shows the rate of reaction of an enzyme such as salivary amylase. If the p becomes too alkaline or acidic, the bonding between R groups of amino acids holding together the active site (particularly hydrogen bonds), are broken. If this becomes extreme, then the enzyme will no longer convert substrate to product and will become denatured. Question: Label the optimum p and the p, which causes the enzyme to become denatured, on the above graph. How enzymes work the lock and key theory

Question: Colour the above diagram as follows: (a) enzyme = green (b) substrate = blue (c) product = red It can be seen from the diagram that the enzyme is unchanged after it produces product molecule/s. The rate of an enzyme controlled reaction is dependent on the rate at which substrate can (a) enter and then bind to the active site to form an enzyme-substrate complex (b) form product and then (c) leave to allow another substrate molecule to gain access. This can be very rapid e.g. an enzyme of catalase can split hydrogen peroxide into water and oxygen at a rate of
7

10 molecules of hydrogen peroxide / second. The enzyme is like a lock and the substrate a key Question: What could increase the rate at which this happens? The amount of substrate, if increased would also make the rate of the lock and key mechanism increase. Denaturing enzymes If the shape of an enzyme changes it can no longer catalyse a reaction. The enzyme has become denatured. The substrate can no longer fit into the active site. An enzyme can be denatured by the follow: Extremes of pH: Each enzyme has an optimum pH at which it works most efficiently. At this pH, the active site and the molecule are a perfect fit. The further away from this pH, the more the enzyme molecule distorts and the less perfect the fit is. Eventually the substrate can no longer fit and the enzyme is denatured. High temperatures: As the temperature increases, the molecules gain more energy. More collisions occur / second and the rate of the reaction increases. Above the optimum temperature, the enzyme denatures and the reaction stops.

Question: Biological washing powders contain enzymes. Explain why the washing powders may become inefficient at high temperatures. 9

At high temperatures, the enzyme may become denatured and will not work. Question: Pepsin is an enzyme found in the stomach. It breaks down proteins into amino acids. Draw a diagram to explain why pepsin cannot break down starch.

Diffusion Moving substances in the body To stay alive the body needs to move lots of different substances in and out of cells across the cell membrane. When we breathe in, oxygen moves from the lungs into red blood cells. It then moves from the red blood cells into body tissue. Carbon dioxide moves from body tissue into the blood. Then it moves from the blood into the lungs. After eating, digested food molecules move from the small intestine into the blood. They then leave the blood and go into body tissue.

10

Question: Substances move in and out of different parts of the body. What do substances have to pass across to get in and out of cells? Substances have to pass synapses to reach other parts of cells. Question: Consider a red blood cell. Describe its journey from lungs to body tissue and back. Explain what it does. What is diffusion? Diffusion is the movement of a substance from a region of high concentration to a region of low concentration.

Diffusion in the body Question: Complete the following text using the words that follow: 11

Molecules enter and leave cells because of diffusion. The molecules travel across the semi-permeable membrane from a high concentration to a lower concentration. Alveoli in the lungs have a higher concentration of oxygen than the blood that surrounds them. The oxygen diffuses into the blood. Carbon dioxide diffuses from the blood into the alveoli (why?). We breathe in an out using muscles and it maintains these concentration gradients to allow gaseous exchange to precede. After eating there will be a high concentration of digested food molecules in the small intestine. This causes the small digested food molecules to diffuse through the cells of the small intestine wall into the blood.

Possible words: wall, digested, precede, cells, concentration, oxygen, diffuses.

Breathing makes sure that there is always a high concentration of oxygen in the alveoli. A good blood supply ensures that as soon as the oxygen diffuses into the blood it is replaced with blood containing very little oxygen. The alveolus wall is only one cell thick so the gases do not have to travel far. Alveoli membrane is permeable to gases and is also moist, which helps to speed up diffusion.

There are large numbers of alveoli; this increases the surface area so more molecules can move across at any one time.

Question: What is meant by diffusion gradient? The diffusion gradient is the rate at which diffusion occurs according to many different variables eg. Diffusion distance. Question: What is meant by gaseous exchange? Gaseous exchange takes place in the alveoli and is the exchange of oxygen and carbon dioxide being taken in or expelled from the body. Question: Why should oxygen continue to diffuse from alveoli to blood and why should carbon dioxide diffuse from blood to alveoli?

12

This is needed so the oxygen that is needed is taken into the body whilst diffusing through the blood to the alveoli ready for the gaseous exchange. Question: Explain why fibre molecules do not diffuse through the small intestine wall. Fibre molecules are too large for diffusion and are not needed to pass through to the small intestine. Changing the rate of diffusion When molecules in a liquid or gas spread out as they move in all directions. This is known as the random movement of molecules. However most of the molecules will move from a high concentration to a low concentration. Hence, diffusion is the net movement of particles from an area of high concentration to an area of low concentration due to the random movement of individual particles. The rate of diffusion can be increased by: Increasing the surface area Decreasing the diffusion distance A greater concentration difference Adapted for diffusion

Diffusion takes place in villi in the small intestine and alveoli in the lungs. Both have special adaptations to increase the rate of diffusion.

13

Question: Colour cells of the wall of the villus in yellow and the blood vessels in red.

Question: Explain why an increase in the surface area of the small intestine increases the rate of diffusion. An increase in the surface area to volume ratio in the small intestine means that you can diffuse quicker as there is a larger area to spread the diffusion around the areas. Question: Explain how carbon dioxide is removed from the body. Include the following words in your answer: diffusion, concentration, and breathing. Whist breathing you need oxygen for many life processes. The oxygen diffuses into the alveolus and with respiration; carbon dioxide is a waste product. This is needed to be expelled from the system and due to the large concentration of it, it is needed to take out of the system by using gaseous exchange. The carbon dioxide is then expelled by breathing out.

14

More on moving substances Diffusion is important when it comes to moving substances into and out of the whole organism. Keeping a foetus alive A foetus growing inside the mothers uterus needs food and oxygen to stay alive. Food and oxygen pass from the mothers blood by diffusion. The foetus makes carbon dioxide and other wastes. These wastes pass from the foetus into the mothers blood.

Movement of substances in plant leaves Plants use carbon dioxide for photosynthesis. They get carbon dioxide from the air by moving it in through the leaves. At the same time, oxygen moves out of the leaves. Plants also lose water. This is lost by evaporation from the surface of the leaves. Question: Name two substances that move from a foetus into the mothers blood. Carbon dioxide and waste. Question: Name two substances that move from the mothers blood into a foetus. Oxygen and food and nutrients. Question: Why do plants need carbon dioxide? Plants need carbon dioxide for respiration and the CO2 is also needed for photosynthesis to create their own energy source.

15

Diffusion and the placenta

The diagram above shows how closely the mothers blood vessels are close to those of the foetus. Notice how the blood does not mix since mother and foetus often have different blood groups. Question: Shade over that part of the diagram, which belongs to the foetus with a yellow coloured pencil Question: Label the arrow / s that show dissolved food and oxygen passing into the foetus blood by diffusion. Question: Label the arrow / s that show carbon dioxide and waste products passing out of the foetus blood by diffusion into the mother lymphatic system which then drains into her blood system. Question: Why is diffusion both ways possible? It is possible as the mothers blood vessels are close to those of the foetus and therefore the close of either diffusion is possible due to this fact. Question: Why would it be dangerous for the mothers blood and foetus blood to mix? If their bloods mixed and they had different blood groups, the mother or the foetus could be killed due to the foreign blood.

16

Diffusion and the leaf Plants use up carbon dioxide during photosynthesis. The concentration of carbon dioxide inside a leaf is low during photosynthesis. The higher concentration of carbon dioxide in the air around the plant causes the gas to move into the leaf by diffusion. It diffuses through the small pores called stomata. During photosynthesis, oxygen levels increase inside the leaf. This causes oxygen to diffuse out of the leaf into the air. Inside a leaf, there are lots of air spaces. Water vapour collects inside the air spaces, diffuses out of the leaf through the stomata and evaporates. More water, brought to the leaf in the xylem vessels from the roots, replaces the lost water. Possible words: water, stomata, diffuses, diffuse, pores, oxygen

Question: The diagram above shows the different tissues in the leaf. (a) Label (and colour where appropriate) this diagram as follows (1) waxy cuticle (light green) (2) palisade mesophyll cells (label the internal structure of one of these cells in detail i.e. cell wall (light green), membrane, chloroplasts (dark green), cytoplasm (yellow), vacuole (3) spongy mesophyll cells (4) stoma (5) guard cells (6) phloem cells (7) xylem cells (cell wall colour dark green) (8) air space Question: Show with labelled arrows the direction of the gases previously mentioned. Remember to also include the movement of water vapour as it enters the air spaces by evaporation from surrounding cells. 17

Question: Explain why the placenta is so important to a developing foetus. The placenta is a protective cushion for the foetus and allows for diffusion to happen between the mother and the foetus otherwise the foetus would not get the nutrients/oxygen that it needs or get rid of the waste products eg. CO2.

Adapted for diffusion The placenta It is important to move substances across the placenta as quickly as possible. To speed up movement the placenta has: A very large surface area A very thin wall so substances only have a short distance to diffuse. The leaf To increase the rate of gaseous exchange, the leaf has a large surface area. The under surface of the leaf also has many stomata through which the gases can diffuse. Synapses A synapse is a gap between two neurones (nerve cells). To carry a signal from one neurone to the next, the synapse releases a transmitter substance. This is a special chemical that can diffuse across the gap between the two neurones. When it reaches the other side of the synapse, it causes an impulse to travel along the neurone.

Question: Using the above diagram, explain how a signal transmits from one neurone to another. The electrical impulse, is carried by a neurotransmitter substance, acetylcholine. This diffuses across the synapse from the Synaptic vesicle and then passes through to the postsynaptic membrane. Question: During pregnancy, part of the placenta could break away from the uterus wall. Explain why this could harm the foetus. The foetus could become deprived of the substances that are crucial for its growth and healthy development of the foetus. 18

Question: Explain why there is less diffusion of gases through the upper surface of a leaf compared with the lower surface. The upper surface is waxy and therefore is unable to diffuse well, also, there is no stomata (gaps) in the top of the leaf so that not as much water is lost through normal matters. Question: Transmitter substance is only made on one side of a synapse. Suggest one reason for this. It is only made on one side so that the electrical impulses can travel faster to its maximum efficiency as diffusion is the net movement of particles from an area of high concentration to an area of low concentration. Keep it moving Scientists have now cloned genetically engineered pigs. They hope these pigs will provide new hearts for humans without the risk of rejection. Is blood really red? Question: Complete the following table showing the different parts of blood and their functions using the text boxes that follow: Part of blood Red blood cells White blood cells Platelets Plasma Function
These cells are adapted to carry as much oxygen as possible. Their red colour comes from haemoglobin. Oxygen joins to haemoglobin, which allows it to be transported around the body. These cells are adapted to change shape. They can wrap around microbes and engulf them. They can squeeze through capillary walls to reach microbes. These are tiny cell fragments, which help to clot the blood when we cut ourselves. This is the liquid part of the blood, which transports substances. It is mainly water containing dissolved substances such as hormones, glucose, amino acids, antibodies, wastes such as carbon dioxide and urea.

Red blood cells do not have a nucleus. This leaves more room to carry oxygen. They are disc shaped and have a dent on both sides. This helps them to absorb a lot of oxygen by increasing their surface area. Red blood cells are very small so they can carry oxygen to all parts of the body. 19

Blood vessels Arteries transport blood away from the heart. Veins transport blood to the heart Capillaries join arteries to veins. Materials such as oxygen are exchanged between the capillaries and the body tissue.

White blood cell engulfing bacteria. Question: Explain the ways that blood cells are adapted to their function. The blood cells can change their shape to engulf pathogens or bacteria and they have many different uses as there is red and white blood cells. Question: Explain why white blood cells need to be able to change shape. They need to change shape otherwise theyll only be able to kill select bacterias and they need to kill all of them. Did you know? Red blood cells are so small 5 000 000 000 will fit into 1 cm cube! Urea is carried in the Plasma of the blood, along with Carbon Dioxide. (Colour the blood vessels carrying O2 RED, those carrying CO2 colour blue)

Question: What passes from the capillaries into cells? Oxygen would pass from the capillaries in to the cells as the cells needed to be fuelled with a substance. Question: What passes from the cells into the capillaries? 20

Carbon dioxide as it needs to be expelled from the system and is now of no further use. More on red blood cells Question: Complete the following text using the words that follow: The shape of a red blood cell means it has a large surface area compared to its volume. This enables it to absorb a lot of oxygen. Haemoglobin found in red blood cells, reacts with oxygen in the lungs to form oxyhaemoglobin. When it reaches tissue it separates into haemoglobin and oxygen. The oxygen diffuses into the tissue cells and the red blood cells return to the lungs to pick up more oxygen. Possible words: lungs, haemoglobin, surface, oxygen Adaptation of blood vessels

Question: complete the following table: Table showing the main structural differences between a small artery, a small vein and a capillary Small artery Small vein Capillary 21

Tunica externa

Contains collagen and some elastic fibres Contains elastic and collagen fibres and smooth muscle Made of endothelium resting on a thin layer of elastic fibres Relatively narrow

Mostly collagen fibres

Tunica media

Very thin containing some smooth muscle and collagen fibres Thinner than artery

Tunica intima

Lumen

Relatively large

Big enough for a red cell to squeeze through

Arteries The function of the arteries is to transport blood swiftly at high pressure to the tissues. The structure of the artery wall enables arteries to do this for the following numbered reasons:

Question: In what ways is the artery designed to aid the flow of blood? The elastic recoil of the artery walls propels blood along the artery allows the blood to flow through the arteries with ease and at a good pace. Question: Why is oxyhaemoglobin such an important molecule and where does it come from? Oxyhaemoglobin is made of the haemoglobin in the red blood cells and oxygen. It is important as it can only be transported around the body when it has been bonded together. Question: Why are the walls of capillaries permeable? 22

The walls of capillaries are permeable as the red blood cells need to get through them well and with maximum efficiency. What does the heart do?

Question: complete the text using the words from the previous diagram The mammalian cardiovascular system consists of large veins, which are collectively termed the transport system. These carry deoxygenated blood from the cells in the body and deliver it to the right atrium. This contracts forcing this blood into the right ventricle. The right ventricle contracts and forces the deoxygenated blood into the lungs through the pulmonary artery. Carbon dioxide is removed from this blood and replaced with oxygen. This oxygenated blood then passes back to the heart through the pulmonary vein. It enters into the left atrium of the heart. The circulation of blood from heart to lungs and back again is called the pulmonary circulation. The left atrium contracts and forces oxygenated blood into the left ventricle. This is a very muscular chamber which contracts forcing this oxygenated blood all around the body through a major artery called the aorta. The circulation of blood from heart to body and back again is called the systemic circulation. This combination of pulmonary circulation and systemic circulation makes a double circulatory system The circulatory system in the fish comprises of a single systemic system with a single ventricle pumping deoxygenated blood to all cells in the organism including the respiratory surface (which then becomes oxygenated) and a single atrium receiving all the blood after it has been deoxygenated by the bodys cells. The advantage of a double circulatory system is that: (1) There are four muscular chambers helping to force blood around the body rather than two, so the overall pressure on the blood will be higher

23

(2) The left ventricle is only acting on that volume of the blood which being forced to the body cells excluding the lungs. This makes the systemic pressure that it generates so much greater. Question: How might a greater systemic blood pressure (and therefore a faster rate of delivery of blood to cells) be an advantage to an organism that has a double blood circulatory system (reptiles, birds, mammals)? It is an advantage as the greater blood pressure will allow the oxygen, waste products and nutrients able to pass through the system quicker and with better efficiency. The vessels making up the blood system are of three main types. These vessels are shown previously in transverse section. Vessels carrying blood away from the heart are known as arteries, while those carrying blood towards the heart are veins. Linking arteries and veins, taking blood close to almost every cell in the body, are tiny vessels called capillaries. Question: Arteries normally carry oxygenated blood and veins deoxygenated blood. What are the exceptions? The capillaries, as they link the arteries and veins together. Question: colour all blood vessels carrying deoxygenated blood in blue and vessels carrying oxygenated blood in red. Heart problems Blood flows through arteries at high pressure. Saturated animal fats such as cholesterol can stick to the walls of arteries. As it builds up it forms a plaque that restricts the flow of blood. Some of this cholesterol can break away and block the artery completely. This can slow down or block the flow of blood. If this happens in a main blood vessel it can cause a heart attack or a stroke. Mending the heart The heart or parts of the heart can either be replaced mechanically or biologically. Mechanically: Sometimes the heart valves do not work properly or they wear out. Special mechanical valves are used as replacements Biologically: If the heart breaks down completely, a heart transplant is needed.

Question: Which side of the heart pumps blood to the (a) lungs (b) rest of body? The right side pumps blood to the lungs and the right side to the rest of the body as the right side is more muscular and able to do so. Question: Describe how cholesterol can cause a heart attack and what can be done in these circumstances. Cholesterol can be built up in the veins and arteries over time and this can raise blood pressure to dangerous levels. This would then cause a heart attack. This can be helped be decreasing the amounts of unhealthy foods in your diet and if exercised more often. Structure and function of the heart Humans have a double circulatory system of arteries, veins and capillaries One circuit links the heart and lungs (pulmonary) 24

One circuit links the heart and the body (systemic)

Did you know? Even though a human heart weighs only 300g it beats about 2500 million times in a lifetime! Colour the oxygenated blood in red and the deoxygenated blood in blue on the diagram.

25

Use the previous diagrams to help you complete the following text:Starting with the cells in the head and the rest of the body, much Carbon Dioxide is produced by the process of Respiration. This is a poison and can kill cells. It is therefore carried away with the blood through Veins back to the heart. The major vein in the body is called the Vena Cava (show this on the diagram). The Vena Cava drains deoxygenated blood (oxygen has been removed by the cells and replaced with CO2) into the Right Atrium of the heart (show this on your diagram). By the way veins are incredible blood vessels. They have to return blood all the way up from the legs to the heart against the pull of gravity! Why doesnt the blood just fall back downward to the legs? Well, the reason is that veins contain a series of Valves. Valves allow the blood to flow to the heart but close up and prevent backflow!

Valve allows blood flow upwards

Valves close up to prevent backflow!

Veins (e.g. vena Cava) have thinner walls than Arteries The valve that ensures that the deoxygenated blood travels in one direction from right atrium to right ventricle is called the tricuspid valve (show this on the diagram). Once the deoxygenated blood is in the Right Atrium of the heart, then this chamber contracts. It forces this blood into the Right Ventricle of the heart (show this on your diagram). The heart is able to contract because it is made up of contractible Muscle fibres. Now the Right Ventricle is a strong muscular chamber (thick muscular walls). When it contracts, it forces the deoxygenated blood through the Pulmonary Artery to the lungs. A valve in the pulmonary artery called the semi lunar valve (show this on the diagram) prevents backflow into the right atrium. In the lungs the carbon dioxide in the blood is removed from the blood and replaced by Oxygen. It then passes back to the left atrium through the Pulmonary Vein. The left atrium contracts, forcing oxygenated blood through the bicuspid valve (show this on your diagram) into the left ventricle. This then pumps oxygenated blood around the body through the aorta.

26

Now the aorta carries the Oxygenated blood to all the cells in the body. There therefore are two blood circulatory systems: 1) Blood travels from the heart to the lungs and back again. This is the pulmonary blood circulatory system. 2) Blood travels from the heart to the rest of the body and back again. Blood flows to the digestive system (intestines). The blood vessels surround the small intestine and permeate into the villi. The cells of the small intestine use up the oxygen in respiration and the digested food (glucose, amino acids) pass into the blood vessels. This food is then carried to the Lungs. Question: Hang on! When the Right Ventricle contracts - blood is forced through the pulmonary artery BUT what prevents backflow into the right atrium? The valves inside the chambers in the heart, the tricuspid and bicuspid valves. Once the blood has been oxygen in the lungs (and CO2 removed) it is sent back to the heart through the Pulmonary Vein Question: An artery carries blood away from the heart. What is so different about the blood in the Pulmonary Artery compared to the blood in all other arteries? It takes blood from the heart into the lungs. Question: Why should the right ventricle wall be thinner than the left ventricle wall? As it has to pump blood to the rest of the body rather than only to the lungs. Question: A Vein carries blood towards the heart. What is so different about the blood in the pulmonary vein compared to all the other veins? It takes blood from the lungs to the heart.

Treating heart disease Question: Complete the following text using the words that follow: Coronary arteries (which extend away from the aorta) supply the heart with food and oxygen (show this on the diagram of the double circulatory system). Too much cholesterol in the diet can lead to the blockage of a coronary artery. This can cause serious heart problems and even the need for a heart transplant. There are problems with heart operations. In heart transplants the donor heart needs to be a close match in size, age and tissue type. As the supply of donor hearts is limited and irregular, the chances of getting a 27

suitable heart are low. After a transplant there is the possibility of rejection and the patient must take drugs to stop their immune system attacking their new heart. Mechanical replacement valves are very small and difficult to fit. Pacemakers can be attached to the heart to help it beat. However, they need internal batteries that have to be replaced. There is also the chance of rejection. Words: batteries, rejection, mechanical, heart, donor, supply, operations, heart, food, cholesterol Question: List the structures that blood passes through as it travels from the vena cava to the aorta. Blood passes from the vena cava into the pulmonary vein and into the heart where it is then passed to the lungs. Out the lungs then into the pulmonary artery and into the aorta. Question: Name three different valves found in the heart and describe the function of each. The bicuspid valve helps keep the blood moving as does the tricuspid valves. The semilunar valve prevents backflow into the right atrium. Question: Explain the problems of eating a diet rich in cholesterol. The cholesterol can build up and can cause a heart attack which will then cause many future problems possibly even death. Question: Suggest two ways to reduce cholesterol in blood. Eat a healthier diet and exercise more often for longer/more frequent intervals. Question: Some babies are born with a hole between the two ventricles in their heart. Suggest why their muscles would receive less oxygen. The blood could become back-flowing and could prevent the blood flowing correctly which would interrupt the amount of blood that is oxygenated and travels to the organs correctly. Question: Describe the advantages and disadvantages of a pacemaker and heart valves over a heart transplant. A pacemaker isnt as reliable and you need replacements every so often at regular intervals however, they are a good way to prevent any further medical conditions. Replacement heart valves are good in the short term but do need to be replaced. Heart transplants are good in long terms but you would need to take immunosuppressants and it is not guaranteed that you would get a suitable donor for your heart replacement. Divide and rule Using a plastic frame under the skin of a mouse to provide a growing frame and a blood supply, scientists can grow human cartilage and skin cells into the shape required. The ability to grow something that looks like an ear can now help accident victims who need cosmetic surgery.

28

Every day thousands of skin epidermal cells are lost from the skin. They are continuously rubbed off. All of these cells need to be replaced. To make new cells the body carries out cell division. Cells divide whenever the body needs to: Grow Replace worn out cells Repair damaged tissue.

Question: Find out what dust is made of. Dust is made of dead skin particles and dirt molecules. The more cells the better Question: Complete the table using the text boxes that follow: Organism Single-celled Advantage
Simple requirements to maintain life

Disadvantage
Size is limited and so too is their complexity and ability to be aware of surroundings and respond to stimuli

29

Multicellular

Can grow large. Cells become differentiated to take on specialised roles. They work together performing particular function (tissue) and tissues work together in a major role (organs). Organs cooperate together in organ systems. Thereby organisms become more (1) aware of surroundings (2) respond to stimuli more effectively.

Need to develop mechanisms to transport food, water and oxygen faster because diffusion alone cannot supply them fast enough.

Dividing cells What is the relationship between alleles and chromosomes? Now remember, alleles are genes and genes are long strands of DNA, coding for a particular feature in an organism (protein), and they are found next to each other in long strands called chromosomes. Chromosomes can be paired together, if they have the same length and shape, and contain similar pairs of alleles as shown below:

Question: Consider the pair of chromosomes above with pairs of alleles coding for similar features shown above (B =brown eye allele, b = blue eye). What is the phenotype that this genotype will code for? _____________________________________________________________________

30

Pairs of chromosomes containing pairs of alleles that code for the same feature are called homologous chromosomes. A cell that contains the full complement of all the chromosomes and therefore genes, which can code for all the features in that organism is called a diploid cell. When diploid cells divide into two daughter diploid cells, we say that a type of cell division called mitosis has occurred. Question: Every human cell has thousands of genes (and therefore alleles), located on 46 chromosomes in their nuclei. How many pairs of homologous chromosomes does every human cell contain? This depends on whether the person ahs dominant or recessive characteristics. Question: If a nerve cell, eye cell, foot cell, all contain the same number of chromosomes and genes, why then do they look different to each other? They have been specialised to their own purpose not the purpose of the similar cell depending on where they are within the body. Question: Which type of human cell does not have chromosomes? Stem cells All living cells require a supply of nutrients, such as glucose. Most living cells also need a constant supply of oxygen. There will also be waste products, such as carbon dioxide, to be disposed of. Very small organisms, such as Paramecium, can meet their requirements for the supply of nutrients and oxygen, and the removal of waste products, by means of diffusion. The very small distances across which substances have to diffuse, means that the speed of supply or removal is sufficient for their needs. These tiny organisms have a large surface area compared to their total volume, so there is a relatively large area of membrane across which gases can diffuse in and out of their bodies. However, what happens when organisms get larger? Will they still have a relatively large enough outer surface area over which gases can diffuse sufficiently quickly enough to reach all parts of their increased volume (and mass)?

31

Question: Consider a 1cm cube. Lets pretend that it is a small organism. Calculate its surface area, volume and surface area: volume ratio. Now lets double its dimensions to produce a larger cube whose sides are 2cm in length (a larger organism). Calculate its surface area, volume and surface: area volume ratio. What do you notice? ______________________________________________________________________ ______________________________________________________________________ ______________________________________________________________________ ______________________________________________________________________ ______________________________________________________________________ ________________________________________________________________ Question: The following diagrams show the different stages of mitosis. Copy the correct text box next to each diagram.

Before the cell divides, the chromosomes in the nucleus are very difficult to see because they are very long and thin.

The chromosomes get much shorter and fatter, so they can now be seen with a light microscope. Each chromosome is made up of two threads of DNA joined by a centromere.

The chromosomes line up along the centre of the cell. Their two threads split apart, and move to opposite ends of the cell.

The threads make up two groups and a nuclear membrane forms around each group. The cell splits into two. Later each thread will make an exact copy of itself to form chromosomes made of two threads again.

32

Question: Does an elephant or a mouse have a smaller surface area to volume ratio? A mouse. Question: Suggest why a large surface area to volume ratio is an advantage to an amoeba. It needs to photosynthesise to its maximum efficiency. Question: Give examples of the types of human cell that will undergo (a) mitosis (b) meiosis. Mitosis could happen in a large cut where the skin needs to be replaced. Meiosis happens in the male testis to make sex cells. Sunny-side up The diagram below shows an unfertilised hens egg.

Question: Complete the following table using the labelled hen diagram to help you. Part of hens egg Yolk Chalaza Shell Germinal diso Function
Fatty food full of energy for developing embryo Holds the yolk in place. This is a strand of twisted albumin Hard outer structural substance that protects the entire egg Protein food for developing embryo

33

Question: During Years 7 and 8 we learned a little about the principles of sexual reproduction. To help us to recap this, complete the following text using the words that follow. During sexual reproduction, special types of cell called sex cells or gametes must fuse together. This joining of gametes is called fertilisation and produces a fertilised egg called a zygote. This zygote then divides many times to form a ball of cells and then either an embryo (animal) or a seed (plant). The male gamete in animals is called a sperm and in plants it is called a pollen grain. The female gamete in animals is called an ovule and plants is called an egg. Possible words: Ovule, egg, sperm, pollen, gametes, fertilisation, seed. Egg Sperm A sperm is much smaller than an egg. It has a tail to help it to move A male releases millions of sperm to increase the chance of one reaching an egg. The nucleus of a sperm contains genes, which are instructions to make new cells. An egg is much larger than a sperm because it contains food for the developing embryo The nucleus of an egg contains genes, which are instructions to make new cells.

Question: Highlight the key differences between a male gamete (sperm) and a female gamete (egg). The male gamete is much smaller and is released in massive numbers as for more chances of fertilisation. The female gamete is much larger and is only released one at a time, once each month.

Lets now see how fertilisation enables alleles to come together within a zygote! 34

Fertilisation and the restoration of the haploid genotype back to the diploid genotype Question: Complete the following text using the words that follow: The cells in the testes, which eventually make sperm, and the cells in the ovaries, which eventually make eggs, have the same number of chromosomes as every other cell in the human body (except sperm and egg themselves). This number is 46 and correlates to 23 pairs of homologous chromosome. This is called the diploid number of chromosomes and this number of chromosomes contains all the genes necessary to make a complete human being. These cells will eventually divide and produce gametes that contain half this diploid number. We say that gametes contain the haploid number of chromosomes. The process whereby cells divide to produce gamete cells is called meiosis. A single sperm or egg does not therefore contain all the genes and therefore genetic information on their own to make a human being. Sperm and egg must fuse or join together (fertilisation) to restore the diploid number back again in a new type of cell called the fertilised egg or zygote which is derived, partly from the father and partly from the mother. This ensures that new combinations of genes arise in offspring, some from the father and some from the mother. This produces different features in offspring causing variation. Once this new cell has been produced, it must divide into a ball containing countless billions of cells, which will produce the embryo. However, this type of cell division must arise in new cells which all have the diploid number of chromosomes so that they have sufficient information to make the new baby. This type of cell division is called mitosis. Possible words: mitosis variation fertilisation zygote, meiosis, haploid, diploid Question: Explain what is meant by mitosis. Mitosis is the exact replication of cells so they are produced genetically identical to al of the other cells in the body. Question: Explain what is meant by meiosis. Meiosis is the change of the genetic code in four daughter cells to increase variation in people/siblings. Moving sperm Sperm have to travel a long way and then get inside an egg. They are specially adapted to do this. A sperm has large numbers of mitochondria to release energy for motion. A structure called an acrosome on the sperm head releases enzymes that digest the cell membrane of an egg allowing the sperm inside.

35

In the middle piece there are many mitochondria to release energy. Question: Where in the body does (a) meiosis take place (b) mitosis take place? Meiosis takes place in the testis or in the ovaries/womb. Mitosis takes place all over the body to repair the body eg. A large cut on your leg. Question: If sperm and egg were diploid how many chromosomes would the human zygote have? 23 pairs, 46 chromosomes. Question: Explain the function of the following parts of a sperm cell: (a) mitochondria The energy source in the sperm cell. (b) acrosome Contains enzymes to digest the outer shell of the ovum before fertilisation.

Meiosis and chromosomes

36

Gametes are made when diploid cells divide by meiosis to produce haploid cells: Firstly each chromosome (and its genes) replicate. The two replicated strands are held together at a structure called a centromere (yellow). The cell divides into two (meiosis 1) and half the chromosomes go into one daughter cell and half the chromosomes pass into the other daughter cell. Each chromosome splits down its length and each strand (called a sister chromatid) passes into one of two new daughter cells following another cell division. Four daughter cells in total are now produced each with half the original number of genes (haploid number). Remember, sperm and eggs are produced by meiosis. Question: Describe in your own words the stages involved when sperm is made inside the testes. Each chromosome and its genes replicate. The replicated strands are then held together by the centromere. The cell divides in two and half of the chromosomes go into one cell and the other half into the other. Each chromosome splits down its length and each strand passes into one of the new daughter cells following another cell division immediately afterwards. Four daughter cells have now been made with genetic differences. Question: Describe two ways in which meiosis is different to mitosis. Meiosis creates 4 daughter cells, mitosis only creates 2. Mitosis creates genetically different cells, meiosis creates cells with different genes (variation).

37

Growing up If a person damages their nerve cells their body cannot make new ones. However scientists have found a way to grow human nerve cells in chickens. They have taken stem cells from human bone marrow and put them into chicken embryos. Stem cells can develop into other types of cell. Normally stem cells from bone marrow turn into blood cells. Scientists have found that these cells can turn into nerve cells in chicken embryos. However, scientists are still a long way off from using this to replace damaged nerve cells in the human body.

Changing cells For a fertilised egg to grow into an embryo and a foetus, the cells need to divide and change. The cells change so they can carry out different jobs. Some cells turn into nerve cells. Others change into bone cells. This change is called cell differentiation. Question: Match up each part of a cell with the job it does. Part of cell Vacuole Cell wall Chloroplast Job absorb light energy for photosynthesis contains cell sap and provides support provides support

Question: What happens to a cell during cell differentiation? The cell changes its purpose to suit a different part of the inhabiting body. Question: What are the differences between plant and animal cells? Animal cells are simpler and only have a cell wall. Plant cells have chloroplasts for photosynthesis and have the cell wall and membrane. Animal and plant growth Animals tend to grow to a certain size and then stop. This is usually faster than plants. A Blue whale calf can have a mass of 26 tonnes before it is a year old. If a stick insect grew too much it could be crushed by the weight of its own skeleton. Question: Why is the delivery of food and oxygen to cells in multicellular animals faster than that in plants? How is it achieved? 38

The cells are more developed and specialised whereas in plants the cells are all stem cells without differentiation.

Tissues cooperate together to produce structures that perform major functions e.g. nervous tissue, lymphatic tissue, blood vessels = brain. Other stem cells are found in the adult. Bone marrow stem cells differentiate into white blood cells and red blood cells. Question: What is a stem cell? They are cells which havent differentiated. Question: What is the difference between differentiated and undifferentiated cells? Differentiated cells are specialised to d a job whereas undifferentiated cells have no exact purpose. Animal cell and plant cell growth The cells of animals and plants cause them to grow in different ways: Plant Most growth is due to cells elongating (growing longer not dividing) Cell division only normally occurs at the tips of shoots and roots Many cells never lose the ability to differentiate Animal Growth is due to cells dividing Cell division occurs all over the body Most animal cells lose the ability to differentiate very early on

Stem cell research Scientists have found ways of making stem cells develop into other specialised cells in the hope of replacing damaged cells. However, many people object to stem cell research because it can involve human embryos. Scientists use embryo stem cells because they are easier to grow than adult stem cells.

39

This photograph shows the root tip of an onion. The black dots represent the chromosomes of the root cells in different stages of mitosis. Question: Describe how growth in a finger is different to growth in a root. The growth in a root is positively geotropic and can only grow one way; growth in fingers is more developed and uses mitosis slower but grows in many ways. Question: What do scientists do with embryo stem cells? Should scientists be allowed to use embryo stem cells? Give one reason for your answer. Scientists can study them and use IVF. Scientists should use them as they can help our understanding of them. Human growth There are five main stages of human growth: (1) (2) (3) (4) (5) Infancy Childhood Adolescence (puberty) Adulthood (maturity) Old Age Gestation Gestation is the length of time from gestation to birth longer in larger animals because more time is needed to develop and so survive outside the uterus. An elephant has a gestation period of 700 days and a rat has a gestation of 22 days. Growth of a baby Different parts of the foetus and baby grow at different rates. The brain and head develop quickly to coordinate the complex human structure and chemical activity.

40

Growth curves After a baby is born it has a regular growth check. The babys weight and head size are recorded. These measurements show if the baby is growing at a normal rate.
Age in months Weight in kg Head size in cm

0 2.5 36.0

3 5.0 41.2

6 6.4 43.6

9 7.5 45.2

12 8.8 46.4

15 9.6 47.2

18 9.8 47.8

21 10.0 48.2

24 10.1 48.6

27 10.4 49.0

30 10.7 49.2

Question: Explain why the gestation period of an elephant is longer than that of a rat. The organism is larger and heavier and is more developed. Question: Which parts of a foetus grow quickest and why? The head would grow quickest as it is where the brain is situated. Question: Plot a graph of the previous table showing growth rate. Stick your graph in the space below. Use the graph to determine when the growth rate is fastest.

Question: Girls on average show a rapid increase in height at about 12 indicative of the onset of puberty. This is evident in boys at about 13, a year later. When girls and boys reach adulthood at about 18, there is on average no further increase in height. Suggest what might happen to the height of adults as they reach old age. Adults can get conditions in old age which causes their posture to weaken and their backs to keel over in a hump.

Growth problems Measuring the weight and head size of a baby is very important. The results can be plotted on a graph and compared with graphs expecting growth. 41

Poor weight can indicate problems with a babys digestive system Larger than normal head size can indicate fluid collection on the brain or separate skull bones not fusing together.

Question: Why should digestive problems affect weight? Digestive problems would restrict the amount of food being digested and the amount of energy which gets passed onto the rest of the body. Question: Which condition relating to abnormal head size could directly affect brain function? Fluid on the brain Controlling plant growth At the end of the summer many gardeners are faced with handfuls of unripe green tomatoes. Most gardeners either throw them away or make tomato chutney. The alternative is to put the tomatoes in a bag with a ripe banana. Over-ripe bananas release a hormone that ripens fruit. Plant hormones Plants make special chemicals called hormones. Hormones control different processes in a plant: Growth of shoots towards light Growth of roots downwards into the soil in response to gravity Growth of flowers Ripening of fruit Plants are sensitive to light, moisture and gravity. Question: Join lines connecting the first and second statements together: Shoots grow Shoots grow Roots grow Roots grow towards moisture in the direction of the force of gravity towards light against (away) from the force of gravity

In order to produce these growth responses, plant cells produce growth hormones called auxins. These are produced near the growing tips of plants (tips of shoot or tips of root). They are unequally distributed, moving from one cell to another and accumulate in specific regions of the plant. There they stimulate more rapid cell division and growth causing the shoot or root to bend and grow towards or away from the stimulus in an appropriate manner.

42

Question: Explain what a stimulus is and what stimuli plants respond to. A stimulus is a environmental condition which causes you to act in a certain way. Plants respond to gravity and light. Question: Explain why roots are negatively phototropic. Roots are negatively phototropic as they need to respond to moisture and gravity, light isnt underground so being phototropic would be a pointless quality. Question: Explain why plant shoots are negatively geotropic Plant shoots need to grow towards light to grow quicker to photosynthesise. Question: Explain one advantage of a plant shoot growing towards the light. It would be able to photosynthesise quicker and therefore grow quicker. Question: Explain one advantage of a plant root growing down into the soil. It can get more nutrients. Question: What effect does auxin have on plant cells? Auxin makes plant cells elongate and stretch towards the light. Question: Describe a simple experiment to show that cress seeds are positively phototropic. 43

Plant many cress seeds at different places around a room in different lights and see which face which way towards the light. Question: If the tip of a broad bean shoot was cut off and a light source placed to one side, would the shoot grow towards the light? Explain. The shoot would grow towards the light as it is needed to grow and photosynthesise to produce its own food. Speeding up growth Farmers can use hormones to either (a) Make plants grow fruit (b) Slow down growth. This stops the fruit from falling off the tree before the harvest.

Question: Highlight all aspects of the previous flow diagram that show the applications of synthetic auxin with a yellow coloured pencil.

44

B3: hormones

Possible words: stimuli, ethene, apples, dormant, rooting, hormones, ginseng, auxin, negative, geotropism, weedkiller, seed, fruit, flowers, synthetic, tropism, gravity, phototropism, ovary

Across 2. Plant hormone produced in the tips of shoots and roots that stimulate mitosis. 4. Control different processes in plants 8. Synthetic hormone in ________ powder helps stimulate mitosis in roots. 10. Plant growth response towards the light by shoots. This would be positive. 12. Roots grow down towards the centre of the earth from which gravity comes. 14. Stimulate the ovary to develop into a fruit without fertilisation of ovules with synthetic hormone and these will not develop. 15. Hormones can make this ripen. 16. This hormone sprayed onto bananas will cause them to ripen. 17. Hormones sprayed on trees can prevent these from falling. 18. A plant is sensitive to this. Down 1. Type of plant that protects the body from disease. 3. Growth of roots is downwards due to this 5. A man made plant hormone called ________ auxin used by gardeners and fruit growers. 6. The seeds from a ginseng plant are this and the hormone gibberellic acid can force germination without a cold period. 7. Growth response in a plant towards or away from a stimulus. 9. A plant will grow away from this type of stimulus. 11. Synthetic hormone can make weeds grow themselves to death. 13. Part of the flower that contains eggs or ovules. 15. Hormones control the development of __________ and the ripening of fruit.

Question: Complete the following table with one-sentence answers; 45

Hormone Synthetic auxin Synthetic auxin Synthetic auxin Ethene Gibberellic acid

Use Control the development of fruit Ripen quickly gardeners, fruit growers Stay fresh to help with slow transport issues Controls fruit state Force germination

Question: Suggest one reason why people prefer fruit that has not been sprayed with hormones. Some could be harmful. New genes for old Scientists have identified a protein that stops tooth-rotting bacteria sticking to teeth. They hope to place the gene that codes for the protein into apples. The apple would then make the protein and eating an apple would stop the bacteria sticking to your teeth! Designing a better cow Question: Complete the following text using the words that follow: To breed a cow that has a high yield (quantity) of creamy milk, farmers carry out selective breeding programmes. Choose a Jersey cow that produces the creamiest milk. Choose a Fresian cow with the highest milk yield. Cross-breed these cows by mating a Fresian cow with a Jersey bull and a Jersey cow with a Fresian bull. Select the best cross breeds i.e. the offspring that produce large quantities of creamy milk. Repeat the selection and breeding process for a number of generations.

Possible words: selection, mating, cow, Fresian, yield Change can also happen by mutation. A gene change usually causes harm to the organism. Haemophilia is a condition in humans where the blood does not clot properly and it can be caused by a mutation. Downs syndrome is caused by a mutation whereby a person has an extra chromosome (additional genes). Some mutations can be an advantage to an organism giving it a better chance of survival. For example, bacteria can mutate and become resistant to anti-biotics. Mutations can be caused by: Radiation such as X-rays Chemicals such as those found in cigarette smoke. Chance.

Possible words: smoke, survival, antibiotics, mutation, clot, mutation, organism. Question: Describe how a farmer could produce a plant with large sweet strawberries if she starts with a plant that has small sweet berries and one with large non-sweet berries. 46

She would select the sweetest berries and the largest berries. She would then crossgerminate them and would produce large, sweet berries. Question: Describe one example of a mutation that is an advantage to an organism. Evolution within an organism to suit themselves to their own environments. Question: Name two things that can cause mutations.
A change in the genetic code and the cross breeding of species so often creating a weakened creature.

Problems with a designer animal Selective breeding often involves animals that are closely related. This is called inbreeding. Inbreeding causes a reduction in the gene pool (the different genes available in a species). With a smaller gene pool there is less variation. For example, cows could lose genes that could help them survive a new disease. Some animals are bred to show in competitions. The more an animal is selectively bred, the more chance there is of harmful recessive genes being expressed.

Bulldogs have been bred with large folds of skin on their faces. This is a recessive characteristic that reduces the chances of the dogs surviving in the wild because of problems with their sight. Question: Why is variation in organisms important? If there was no variation the species would not be able to evolve and many genetic abnormalities could be passed on easily. The problem with mutations When a gene mutates the DNA base sequence is changed. Spot the change in the sequence of DNA Original base code = CACTTGGTCAAA Mutation = CACTTGTCAAA Question: What is the difference in the base sequence? One Guanine bond has been taken out of the sequence. A change in the sequence changes the protein that is made or even prevents its production. Look at the messages: 47

Bring thermos on outing Bring mothers on outing Thermos and mothers have the same letters but in a different order. The messages have different meanings. In a similar manner, changes in the base sequence can lead to a different order of amino acids in the proteins that they code for. Cystic fibrosis is caused by a mutation in DNA. Sufferers have breathing problems caused by a change in the base sequence so a different protein is made. Question: What might cause this change in the base sequence? A mutation of the DNA could change the order of the bases. Selecting the best Question: Complete the following text using the words that follow: Farmers are always trying to make their animals and plants produce more. They choose animals and plants with the characteristics they want. Then they breed them to produce offspring that have the characteristics. Plants and animals can also change by a process called mutation. A mutation happens when there is a change in an animal or plants genes. Possible words: characteristics, breed, plants, animals, mutation, genes Question: Why do farmers want to plant wheat crops that grow quickly? So they can gain more money from their crops in quick succession. Question: Why do farmers want pigs that produce a lot of baby pigs? So they can produce more meat and gain more money at one period of time. Question: Name one characteristic of strawberry plants that is useful to gardeners. Large strawberries.

Transferring genes Scientists can take genes from one organism and put them into a different organism.

48

Would a square tomato be useful? Would bacteria modified to produce insulin be useful?

Scientists have put a jelly-fish gene into mice. This makes the mice glow in the dark! Question: Suggest how the following may be useful. (1) A square tomato. Useful for growing competitions. (2) Maize that is resistant to weedkiller. Useful to farmers who want weeds to be killed but their crops still okay. (3) Bacteria that produce insulin. Useful for those that suffer with diabetes to replace some of their lost insulin. Question: Copy and replace the sentence using some of the words that follow. When a scientist takes genes from one organism and puts them into another it is called genetic engineering. Possible words: cells, genes, genetic engineering, genetic patchwork What happens in genetic engineering In genetic engineering, the DNA of an organism is deliberately altered and changed. It is now called a genetically modified organism. Usually this is by introducing a gene that will make a useful product. 49

The human insulin gene can be introduced into the DNA of the bacterium E.coli. The pancreas of a diabetic cannot produce insulin. Insulin is needed to remove excess glucose from the blood, which would otherwise cause serious problems. Large quantities of pure insulin can be made by genetically engineered E.coli, which is desperately needed by these diabetics. People living in Asia often eat a diet lacking in vitamin A containing large quantities of rice. Vitamin A is needed to prevent night blindness where one cannot adjust to dim light. Scientists have taken the gene to make beta-carotene from carrots and have put them into rice plants. Humans eating the rice can then convert the beta-carotene into vitamin A.

Advantages and disadvantages Changing an organism by genetic engineering and selective breeding can have many uses. Scientists are developing crops resistant to herbicides, frost and disease. However, both methods can cause unexpected problems. Some people are worried how our bodies will react to eating GM foods several years in the future. Question: How is the production of insulin by genetic engineering different to the production of beta-carotene? Beta carotene making gene has been inserted into a plant whereas the insulin making gene has been inserted into a bacteria. Question: What is a possible disadvantage of using genetically engineered insulin and beta-carotene? They can help those that suffer with diabetes or a lack of beta carotene in their diets. How genetic engineering works

50

Enzymes are used to cut a gene out of an original chromosome and splice it into a new chromosome. Genetic engineering: right or wrong? Genetic engineering allows us to combine fish, mouse, human and insect genes in the same person or animal. It is for this reason that many people worry that we are playing god with nature! Question: Describe how genetic engineering could be used to make glucagon hormone, which causes the breakdown of liver glycogen into blood glucose. The gene for making glucagon can be isolated and put into another useful item for which we could take as supplements eg. Vitamin tablets. Question: Would you like to eat GM crops? Explain your answer. I wouldnt like to as these have been changed to suit or purposes when there are products out there which we can manage with perfectly fine without any testing hassles. More of the same The process of cloning is used to make copies of plants and animals. The copies are called clones. Clones are genetically identical. They all have the same DNA as the original animal or plant. Cloning involves only one parent. It is an example of asexual reproduction. Natural clones Clones are genetically identical organisms. Sometimes clones are produced naturally. Human twins can be genetically identical. They are called natural clones. Question: Why is cloning an example of asexual reproduction? Cloning is used with stem cells and it does entail the full growth of a new organism, just one that has been changed. Question: What was the first animal to be cloned from an adult? 51

Dolly, the sheep. Question: What is special about the DNA of a clone and its parent? They are genetically identical. Question: Why are identical twins called natural clones? They were produced by sexual reproduction when the ball of cells split in half to form identical genes. Cloning cows Most offspring can be obtained from high quality cows by using other cows to rear their embryos. Hormones are used on the donor cow to stimulate her ovaries to release several eggs. Fertilisation is by AI. After a few days, but before implantation, the embryos are flushed out. Each embryo is immediately placed in the uterus of a prepared cow that will act as a surrogate mother. In this way a good cow can have more genetic offspring than would normally be possible in her lifetime. It may soon be possible to select the sex of the embryo before being placed in the second cow. Question: Number the following sentences in order. (1) Hormones are used on the donor cow to stimulate her ovaries to release several eggs (2) It may soon be possible to select the sex of the embryo before being placed in the second cow. (3) In this way a good cow can have more genetic offspring than would normally be possible in her lifetime. (4) After a few days, but before implantation, the embryos are flushed out. (5) Most offspring can be obtained from high quality cows by using other cows to rear their embryos. (6) Fertilisation is by AI. (7) Each embryo is immediately placed in the uterus of a prepared cow that will act as a surrogate mother

52

Importance of cloning Cloning of animals has very important uses. Scientists are hoping to clone pigs to supply organs for transplants into humans. Human embryos could also be cloned to provide stem cells. Stem cells could be transplanted into people suffering from diabetes so that they could make their own insulin. However, people are concerned that this would be unethical because the embryo is a living thing. Some people are also afraid that scientists will eventually be able to clone adult humans.

Question: Describe the process of embryo transplantation. A surrogate mother is chosen and sperm is collected. The sperm is artificially inseminated into another female gamete and is placed in the surrogate mother for it to develop and thrive. Question: Give examples of how cloning can be of use. Cloning can help gardeners to produce more high quality goods in quick succession. Question: Explain why some people are concerned about human cloning. Some say that it is unethical and inhumane to be copying someones identity. Cloning sheep The clones from embryo transplants are clones of each other. Question: The original embryo formed from a fertilised egg. Does this mean that the clones from embryo transplants are also clones of each other? Explain your answer. If they have been taken from the same nucleus and stem cell, then they are cloned of each other as the stem cells are identical so they will be also. Remember, the clones are a mixture of two parents. Dolly the sheep was different. She was genetically identical to her single parent. 53

Dolly was cloned using the DNA in the nucleus of udder cells. The process is called nuclear transfer.

Question: An egg divides by mitosis and produces a foetus in a surrogate mother sheep. However, that egg was never fertilised by a sperm. Explain how this was possible. The egg was created with the shell of the gamete but with a fully grown cell inside eg. A cheek cell.

Risks involved in cloning There is a low rate of success. There were 227 attempts to clone a sheep before Dolly was born. Research into human cloning raises many moral and ethical issues about creating life and then using it to help others. Dolly died of conditions linked to old age, yet she was only seven years old. Her DNA may have been old before she was born. Benefits of cloning Cloned pigs could make up for a shortage in transplant organs and patients needing a transplant would have to wait for someone to die. Diseases could be cured using embryonic stem cells.

Question: Explain why Dolly was not related to the sheep that gave birth to her. The sheep that gave birth to Dolly was not related to her as she would have been a clone of the grown cell of the sheep, not the gamete. Question: If you need a new heart would you object to one from a cloned pig? Explain its advantages and disadvantages. I would reject one from a cloned pig as I feel that it is unethical but it can save many lives and help with medical researchers.

54

Question: A friend objects to the use of embryonic stem cells. Write a short passage to persuade them they are wrong. Embryonic stem cells can save many lives. If you needed a transplant and your family werent a match, and there were no donors, what would you do..... die? Asexual reproduction in plants Question: Complete the following text using the words that follow: Many plants reproduce by asexual reproduction. This process produces new plants very quickly. In asexual reproduction there is no fertilisation between male and female gametes. New plants are produced using cell division only. The new plants are clones of the parent plant. The part of the potato we eat is the tuber. Left long enough, it will grow shoots and roots from the eye (bud) Strawberries grow stems called runners. The runners spread over the ground and have buds that grow into new strawberry plants. Spider plants grow new plants on their stems. These new plants are called plantlets. If the plantlets are cut off the parent plant and planted in soil they grow into adult plants.

Possible words: plantlets, strawberry, runners, soil, tuber, cell, clones, fertilisation, asexual reproduction. New plants from old A small piece of a healthy plant is removed. It is kept in conditions that help it form roots and grow into a new plant. Stem cuttings are used for the propagation of many glasshouse plants. For some plants, leaf or root cuttings are better than stem cuttings. Rooting powder can be used to stimulate the growth of new roots. Rooting powders contain chemicals that stimulate plant growth. They may also contain fungicides to prevent rot. Procedure

55

Why clone plants Advantages All the plants are genetically identical. All the cuttings taken from a red rose grow into red roses. Plants can take a long time to grow from seeds. Cloning produces a lot of identical plants more quickly. Cloning enables growers to produce plants that are difficult to grow from seed such as bananas. 56

Disadvantages The plants are all genetically identical. If the environment changes or a new disease breaks out it is unlikely that any of the new plants will survive. Cloning plants over many years has resulted in little genetic variation.

Question: Gardeners are trying to grow old varieties to increase genetic variation in vegetables. Why is variation in a species beneficial? Variation ensures the evolution of species/organisms and helps the understanding of many organisms and situations in the world. Question: Describe how you could produce five clones from a potato tuber. The potato tuber would grow eyes off of it, these can then be chopped off and placed in another pot to create another potato plant. Tissue culture

Question: What is meant by the following terms: (1) Clone An organism that is genetically identical to another. (2) Micropropagation (or plant tissue culture) The re-planting of parts of plants eg eyes of a potato plant which will grow into a genetically identical plant. (3) Callus __________________________________________________________________ (4) Culture medium __________________________________________________________________ 57

Question: Why is small tissue samples taken from the tips of shoots or roots? So they can grow larger into more of the plant to ensure that the plant can be used in many ways or even for researchers. Micropropagation (tissue culture) has two major advantages for the grower: (1) Thousands of identical plants can be produced in a relatively small space (2) The new plants are free from organisms that cause disease. Animal or plant clones? Humans have been cloning plants for hundreds of years. Animals have only been cloned over the last few years. Why is this? Many plant cells, unlike animal cells, retain the ability to differentiate into different cells. Root cells used in tissue culture have to change into all the different types of cells found in a plant. Most animal cells have lost the ability to differentiate.

Question: Explain the term aseptic technique. ______________________________________________________________________ ____________________________________________________________________ Question: Suggest two suitable conditions needed for tissue cultures to grow into plants They need light conditions to grow and a humid, warm atmosphere. Question: Explain why strawberry plants are easier to clone than sheep. They are easier to clone as they have not yet become specialised.

58