The 2nd International Symposium „VERA JOHANIDES”

BIOTECHNOLOGY IN CROATIA by 2020

Zagreb, May 10-11, 2013

Role of S-layer proteins in probiotic activity

of Lactobacillus strains

Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković

Laboratory for antibiotic, enzyme, probiotic and starter cultures technology

Department of Biochemical Engineering
Faculty of Food Technology and Biotechnology, University of Zagreb, Croatia
 Strategy for the selection of probiotic strains in
Laboratory for antibiotics, enzymes, probiotics and starter cultures technology
(Šušković et al., 1992.)
Accurate BCCM confirmed taxonomic nomenclature of our 9 selected strains:
Lactobacillus helveticus M92, L. plantarum L4, L. brevis D6, L. brevis ZG1,
taxonomic L. brevis SF9B, L. paraplantarum SF15B, L. fermentum A8, Enterococcus
identifications faecium L3, E. faecium A7…

General Biosafety GRAS (Generally Regarded As Safe, according US FDA) status of selected strains

Resistance to pH, gastric juice

bile, pancreatic juice
(Antibiotic susceptibility)
Technological Activity and viability
(production/processing)
PhD Thesis (Šušković, 1996)
PhD Thesis (Šušković, 1996)
Master Thesis (Kos, 1995)
PhD Thesis (Uroić, in progress)

Antimicrobial activity PhD Thesis (Šušković, 1996)

Antagonism to pathogens
Adherence to intestinal
Functional epithelium/tissue
Master Thesis (Frece, 2003)
PhD Thesis (Leboš Pavunc, 2012)
PhD Thesis (Kos, 2001)
PhDThesis (Uroić, in progress )
PhD Thesis (Beganović, 2008)

aspects PhD Thesis (Šušković, 1996)

Influencing
metabolic activities
Stimulation immune response
PhD Thesis (Kos, 2001)
PhD Thesis (Leboš Pavunc, 2012)
PhD Thesis (Frece, 2007)
PhD Thesis (Beganović, 2008)
PhD Thesis (Uroić, in progress)
 Characteristics of Lactobacillus S-layer proteins
• monomolecular crystalline arrays composed of (glyco)proteins
• located on external side of cell envelope
• identified in different microorganisms from the domains of Bacteria and Archaea
• detected in just a few strains among 117 know Lactobacillus species:
– lower MW : 25-71 kDa
– highly basic proteins (pI = 9.35-10.4)
– mostly non-glycosylated
– signal peptide (N- terminal secretion signal ) typical for Sec pathway (25-30 AA)

cell membrane
cell wall
S-layer

S-layer present on the L. brevis D6 cell surface

performed by transmission electron microscopy (PhD in progress, Ksenija Uroić)
 Detection of S-layer proteins of Lactobacillus strains
from Laboratory of antibiotics, enzymes, probiotics and starter cultures technology
SDS-PAGE surface protein profiles slpA gene (GenBank acession number HM140425)

S-layer proteins:
1. L. paraplantarum SF15B
2. L. brevis D6
3. L. brevis ZG1
4. L. brevis SF9B

PCR analysis with the specific primers

ATGAAGAAAAATTTAAGAAT and
CACCGATCTTGTAGTA.
1 2 S

1. L. helveticus M92
2. L. plantarum L4
S- DNA standard
 L. helveticus M92 S-layer protein identified by SDS-PAGE coupled to LC-MS/MS

S 1

(LC-MS/MS)
SlpA nESI linear ion trap-MS
protein

Nano HPLC
Peptide separation

S – low MW protein standard;

1 – S-layer, purified by dialysis

Peptide sequences assigned to SlpA protein by Bioworks 3.2.

Beganović et al., (2010) Journal of Proteomic Research, 9 (2): 677-688

Beganović et al., (2011) Antonie van Leeuwenhoek, 100 (1): 43-53
 Role of S-layer proteins in probiotic activity
of Lactobacillus strains
1. Adhesion of Lactobacillus strains to IPEC-1 cell line
(porcine intestinal epithelial cells)

Lactobacillus strains are labeled by thymidine and the radioactivity of the samples was
measured by liquid scintillation (L. helveticus M92 as reference strain)
 Role of S-layer proteins in probiotic activity
of Lactobacillus strains
2. Inhibition of adhesion of enterotoxigenic Echerichia coli
to IPEC-1 cell line by Lactobacillus strains

- COMPETITION - - DISPLACMENT - - EXCLUSION -

simultaneous addition of addition of Lactobacillus addition of Lactobacillus
Lactobacillus and after incubation before incubation
E. coli ERL 2055 of E. coli ERL 2055 of E. coli ERL 2055
 Role of S-layer proteins in probiotic activity
of Lactobacillus strains
3. Imunomodulation mediated by Lactobacillus purified S- layer proteins
• Extraction of S-layers from Lactobacillus cell surface
1 2 3 4 5 6

1 - L. brevis GRL1
2 - L. amylovorus GRL 1110
3 - L. amylovorus GRL 1111
4 - L. amylovorus GRL 1112
5 - L. helveticus M92
6 – L. plantarum D6
 Induction of IL-1, IL-6, IL-10, IL-12, TNF cytokines production
in human monocyte-derived dendritic cells with Lactobacillus strains and purified
S-layer proteins - determined by cytokine specific ELISA
Stimulation of HEK Blue cell lines -TLR2, TLR4, TLR5 and NOD2-
with Lactobacillus strains and purified S-layer proteins
Maturation of dendritic cells in response to Lactobacillus bacterial cells and purified
S-layer proteins analysed by Flow Cytometric Analysis (FACS)

Bacteria/S-layer proteins
induced expression of
moDC maturation markers
HLA class II, CD86 and
CD83
 Biotechnological protocol in
Laboratory for antibiotics, enzymes, probiotics and starter cultures technology,
for probiotic and starter culture production technology
Collection of lactic acid bacteria (ZBMK)
over than 300 characterised LAB strains

Inoculation Phenotypic characterisation

probiotic strain / starter culture
Inoculum
Growth medium
Production process control:
Growth - microbiological control
Sterilisation - genetic control

Nutrient medium removal

Wet biomass of probiotic / starter

culture
MICROENCAPSULATION lyoprotectant addition

LYOPHILIZATION
microbiological control
genetic control

MIKROENCAPSULATION

microbiological control
functionality control
genetic control Probiotic bacterium/
starter culture
SCIENTIFIC PROJECTS & COLLABORATIONS:

o National scientific project

“Probiotics, prebiotics and functional starter cultures” No. 058- 1990-
2007

o International project
SEE-ERA.NET PLUS: PSALAB No. 195/1

Project leader: PhD Jagoda Šušković, full prof.

o Collaborative project
with research team of PhD Airi Palva, prof., University of Helsinki, Finland