DNA Technology in Forensic

Settings

http://learn.genetics.utah.edu/units
/biotech/gel/
 What is DNA?
• Deoxyribonucleic acid (DNA) is material
that governs inheritance of eye color, hair
color, stature, and many other traits
• Is unique for each individual except for
identical twins

Just about every cell in our human

body contains a complete DNA
profile (exception red blood cells,
egg and sperm cells)
Chemical Structure of DNA
What is DNA composed of?
A
Adenine (A)
adenine (A) is always
matched with thymine (T)
cytosine (C) is always
matched with guanine (G)
These are called base pairs and they are the
building blocks of DNA
The order these building blocks appear in a
particular strand of DNA is always the same for
an individual but is unique between individuals
The particular order of the DNA base pairs is
what is capitalized on in order to identify an
individual
 Locus:
Location in
DNA strand

AATTGCCTTTAAAAT

Way to describe a piece of DNA

The DNA code, or genetic code is passed
through sperm and egg from the parents to the
offspring
 What are chromosomes?
• Bundled DNA when
cells are getting ready
to divide
• There are 23 pairs of
chromosomes in
human DNA including • Alleles variations on particular
one pair of sex site on a chromosome
chromosomes • If alleles are identical at a
• Females two X particular locus, person is
homozygous for trait, if not
chromosomes
person is heterozygous for trait
Male one X one Y
 Quick Check
1. DNA is composed of nucleotides that are
joined together by covalent bonds between
which two portions of each nucleotide?
a. between deoxyribose and a phosphate
group
b. between the two deoxyribose groups
c. between the nitrogen containing groups
d. between a phosphate group and the
nitrogen containing ring
e. beween the phosphate groups of the two
nucleotides
 Quick Check continued
2. In the hydrogen bonds between nitrogen
containing bases ___________.
a. A always pairs with C
b. A always pairs with G
c. C always pairs with T
d. G always pairs with T
e. G always pairs with C
 What does this have to do with
forensic DNA testing?
• All DNA testing makes use of these properties of DNA to
work
• Two main types:
– RFLP (Restriction fragment length polymorphism)
– STR (short tandem repeats)
Both often make use of PCR (Polymerase chain reaction)
 
What is PCR?
• A way to increase the amount of DNA available for typing
– does not actually type the DNA itself
• It amplifies the variable regions of DNA
• Allows old, damaged, or miniscule quantities to be used
                                                                                             

                    

 
 PCR Replicates like DNA does
• http://www.dnalc.org/ddnalc/resources/pcr.
html
Animation of PCR
 PCR Contamination
• Can be a very serious problem
• A single piece of DNA can be amplified to
billions of copies in 3 hours
• Contamination will nullify the evidence
• Proper quality control procedures must be
in place
 Read Part 1 of the Case of the
Druid Dracula
1. DNA differences can be used to identify people. For example, there is a gene found on both
the X and Y chromosomes called amelogenin, but the version of the gene found on the X
and Y chromosomes differs in length, so it can be used to tell if a blood stain, such as the
one found on the windowsill inside Mable Lyshon’s house, was left by a man or woman.
This stretch of nucleotides shows one strand of the DNA double helix for the amelogenin
gene; what is the sequence of the other complementary strand?
5′CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG3′

a.3′ACTGTTAGATTTCCCTTTTTAGGTCTAGGTCCGTCGGCCTTATTTCCGAGGAATAA5′

b.3′GGGACCCGAGACATTTCTTATCACACAACTAAGAAATAGGGTTTACAAAGATTCAC5′

c.5′GGGACCCGAGACATTTCTTATCACACAACTAAGAAATAGGGTTTACAAAGATTCAC3′

d.3′CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG5′

e.5′CCCTGGGCTCTGTAAAGAATAGTGTGTTGATTCTTTATCCCAGATGTTTCTAAGTG3′
2. To assist the investigators with the crime, you will need to perform
Polymerase Chain Reaction (PCR) to create copies of this gene so
the sizes can be compared to determine if the blood was from a
man or woman. During PCR it will be necessary to break the
hydrogen bonds of the base pairs. Where are those hydrogen
bonds normally found?

a.Between two nitrogen-containing bases in a single strand of DNA.

b.Between the phosphate and sugar of the same nucleotide.
c.Between the sugar of one nucleotide and the phosphate of a different
nucleotide.
d.Between one nitrogen-containing base on a single strand of DNA and
another nitrogen-containing base on the complementary strand of
DNA.
e.Between one phosphate on a single strand of DNA and a sugar on
the complementary strand of DNA.
3. PCR creates copies of DNA using the exact same mechanism used
by your cells to copy their own DNA (replication). Place the steps
listed below in the order in which they occur during replication:
A) two strands, one new and one original template, wind together to
form the double helix.
B) short stretch of primer (~20 nucleotides exactly complementary
to the gene that is going to be copied) is made.
C) separation of the double helix from two parental DNA strands.
D) use of parental DNA as a template so that nucleotides are
covalently bonded together to form a new chain that is
complementary to the bases on the original template.

a.) A, B, C, D
b.) B, C, A, D
c.) D, B, C, A
d.) C, B, D, A
 RFLP uses
• Requires more • The test takes
sample and fresh anywhere from 3
sample if used alone weeks to three
• It examines more months to complete,
base pairs that have a also.
high probability of
being unique to
individual
• Used in DNA lab
coming up
 How is RFLP done?
1. DNA from crime-
scene evidence is cut
with a restriction
enzyme
• Restriction enzyme
recognizes a • In order for RFLP to work,
particular short the analyst needs
sequence of DNA that thousands of cells. If all
is likely to occur many are present from a single
individual, they will be cut
times in a given cell’s
in the same place.
DNA such as AATT
 How is RFLP done? (cont.)
• Cut DNA is sorted on gel
by electrophoresis
• Gel allows small
fragments to travel faster
than large ones
• Location of DNA is
visualized by staining or
blotting
• Sizes of fragments are
compared between
different samples
 RFLP Problems
http://www.biology.arizona.edu
/Human_bio/problem_sets/DN
A_forensics_1/01Q.html
Another example
 What is STR?
• STR (short tandem AGCTAGCTAGCTAGCT
repeats): Region of a
DNA molecule that • Short length makes the
contains short DNA less susceptible to
segments that repeat degradation
over and over again • Their short length makes
• The STR strand is them ideal candidates for
PCR, thereby overcoming
short, less than 400 the limited size of sample
base pairs in length often encountered in
crime scene samples
How is STR done?
• The particular sequence sought is
extracted and amplified from sample
• Sample is separated on gel
• The distance STR has migrated on gel
correlates with number of repeats
• # of repeats individual has for particular
locus will vary
• Frequency of STR sequences must be
known for given population
 How are the results of an STR
analysis used?
STR African- • What is the likelihood that
U.S.
American Caucasian
two, otherwise unrelated
S3s1358 0.094 African-Americans would
0.075 have the same TH01
Must know frequency of
signature? STR
vWA 0.063 0.062
sequence for given population
• Same TH01 and TPOX?
• Same TH01, TPOX, and
FGA 0.033 0.036 vWA?
• What certainty would you
TH01 0.109 0.081 like to see in these
numbers before you
TPOX 0.090 0.195 convict?
Which of the above (A or B) represents the profile
of a man?

Back to the Case of the Druid Dracula

• Did
suspect 1
or 2
commit the
crime?

• suspect #1
• suspect #2
2. There are only a few different numbers of
repeats that are seen in our population—only 5
different TPOX STRs for example. By testing
thousands of DNA samples, researchers know
the distribution of these different STRs in the
general population; those allele frequencies are
shown in the table below. Using these
frequencies, one can determine the probability
that someone else at random would have the
same matching pattern. For example, what is the
likelihood that someone else at random would
have the same pattern of Matthew Hardman (a 5
and 7 repeat for the THO1 STR)?

A.1/200 B. 1/206 C. 1/1200 D. 1/2600 E. 1/20060

3. What is the probability that someone else at
random would have that same pattern of THO1
5 & 7, TPOX 8 & 9, and CSF1PO 11 & 12?

a. 1/1600
b. 1/7200
c. 1/17600
d. 1/172800
e. 1/1555200
 Mitochondrial DNA
• Found outside nucleus
• Inherited solely from mother
• Every cell contains hundreds to thousands of
mitochondria therefore there are hundreds to thousands
of copies of mtDNA in every cell vs. just one copy of
nuclear DNA in each cell

Useful in situations where nuclear

DNA is degraded by age or fire,
not present in large enough
amounts (hair shafts), or when a
reference sample cannot be
obtained
 Using DNA to Solve Crimes
• CODIS
Has allowed
Combined
thousands
DNA Index
of crimes
System:
to be
Allowsand
linked investigators
solved to compare DNA
• types recovered
Currently 13 STRsfrom
arecrime scenes
encoded intowith
DNA
CODIS from convicted sex offenders and
• other criminals
Has allowed 373 case matches since its
advent
 Case study: Using mtDNA to establish
identity in the case of Anastasia Romanov
Case Study: Two Peas in a
Pod
The Case of Questionable Twins