Please go to:

https://is.gd/molbiotraining2018

Download files under Lecture 3.1 and 3.3

(5 files total)(click each)
 Lecture 3.1
Capillary Sequencing
Sanger Sequencing: Overview
•Modern technology has advanced genetic
studies into a new level, with the ability to
determine the actual sequence of
nucleotides in a DNA/RNA

•Knowing the sequence of a DNA/RNA

strand opens up a broad field of knowledge
with various applications.

• The Sanger Sequencing (also known as

Chain-Termination Sequencing) is one of
the earliest form of DNA sequencing
methods, based on modified PCR and Gel
Electrophoresis.
Sanger Sequencing: Video
Capillary Sequencing: Overview
• DNA sequencing technology has
advanced from the two-dimensional
chromatography methods from the
1970’s, to powerful microchip-based
technologies in the late 2000’s.

•Sanger Sequencing has been largely

automated by machines, using capillary
tubes, fluorescent tags, and advanced
software to decrease running cost and
increase throughput and accuracy.
Capillary Sequencing: Illustration
Capillary Sequencing
• ADVANTAGES
• Long read lengths – up to 900 base pairs, which is currently the
3rd longest read length among current sequencing technologies.
• Cost (up-front) – Sanger sequencing is capable of sequencing
single PCR reactions, which is economically advantageous for
small sequencing projects. Other sequencing methods may have
lower cost per base, but require a large minimum number of
bases for sequencing.

• DISADVANTAGES
• Cost (per base) – Although Sanger Sequencing is relatively cheap
for small sequencing projects, the current cost per base is more
expensive than most sequencing methods
• Sample requirement – requires a large amount of DNA, which
must be attained either via PCR or plasmid cloning.
 Workshop 3.1
Capillary Sequencing
Capillary Sequencing: Workshop
• Go to: https://is.gd/molbiotraining2018
• Download Workshop files 1-4 under
Lecture 1.3
Capillary Sequencing: Workshop
• You will get 2 SEQ files and 2 ABI Files
• Try opening the 2 SEQ files. What do you see?

>PSV.PS_PSF_070.ab1
CCARRAMTTTTGCATCATTCATGATCATTCTTTTGTTATATTACTGTCTCTGCGGCTTT
TGGTGGTCATAGTGGTGCCAA
CCTCATTGCATCTGACACTACTATCAATGGGTTTAGTTCTTTCTGTGTTGACACTAGA
CAATTTACCATTACACTGTTTT
ATAACGTTACAAACAGTTATGGTTATGTGTCTAAGTCACAGGATAGTAATTGCCCTTT
CACCTTGCAATCTGTTAATGAT
TACCTGTCTTTTAGCAAATTTTGTGTTTCAACCAGCCTTTTGGCTGGWGCTTGTACC
ATAGATCTTTTTGGTTACCCTGA
Capillary Sequencing: Workshop
• Open GeneStudio
• Go to Contig Editor (Left Pane under Components)
• Click File  Import Sequences
• Choose the 2 .ab1 files
• PSV.PS_PSF_070.ab1
• PSV.PS_PSR_093.ab1
• Click Open
• A window will appear asking if you want to assemble
the sequence. Choose Yes  OK
• An edit contig window will appear. Click Cancel
Try browsing through the sequences
Note: you are seeing an alignment of 2 sequences
-coding strand
-template strand
Change Enable
Height, Show all
Y Scale, Enable
X Scale Quality
 Highlight and
change positions
26 and 27
…..
•Click File Export Current Consensus
•Name it as Psv corrected
•Save to Desktop
• Open your output file
GeneStudio Sequence output (fasta file)