Source Materials

 Jiawei Han & Micheline Kamber, Data Mining:

Concepts and Techniques, Morgan Kaufmann,
2001.

 Tom Mitchell, Machine Learning, McGraw-Hill,

1997.

1
 UNIT –I Introduction
 Data Mining, Data Mining Task Primitives,

 Data: Data, Information and Knowledge;

 Attribute Types: Nominal, Binary, Ordinal and Numeric

attributes, Discrete versus Continuous Attributes;

 Introduction to Data Preprocessing, Data Cleaning:

Missing values, Noisy data; Data integration: Correlation
analysis; transformation: Min-max ; data reduction: Data
Cube Aggregation, Attribute Subset Selection, sampling;
and Data Discretization: Binning, Histogram Analysis
normalization, z-score normalization and decimal scaling
 What is Data?
Data is a stream of raw facts representing
things or events that have happened.
we usually say that data is made up
from four basic types:
• Numbers
• Text
• Images
• Sound
A collection of text, numbers or symbols in
raw or unorganized form
 Example
Example
3, 6, 9, 12

cat, dog, gerbil, rabbit, cockatoo

161.2, 175.3, 166.4, 164.7, 169.3

 What is Information?

• Information is data that has been processed to

make it meaningful and useful

• Data + Meaning = Information

Data refers to raw input that when processed or

arranged makes meaningful output. Information is
usually the processed outcome of data. When data
is processed into information, it becomes
interpretable and gains significance.
 Example
Looking at the examples given for data :
 3, 6, 9, 12
 cat, dog, gerbil, rabbit, cockatoo
 161.2, 175.3, 166.4, 164.7, 169.3

Only when we assign a context or meaning does the data become

information It all becomes meaningful when we are told:

 3, 6, 9 and 12 are the first four answers in the 3 x

table
 cat, dog, gerbil, rabbit, cockatoo is a list of household
pets
 161.2, 175.3, 166.4, 164.7, 169.3 are the heights of
15-year-old students.
 Knowledge

Information + application or use = Knowledge

• Data and information deal with facts and
figures
• Knowing what to do with them requires
knowledge
 Difference between Data,
Information and Knowledge

January 19, 2022 Data Mining: Concepts and Techniques 8

 Next…
 Attributes and Objects

 Types of Data

 Data Quality
 Data objects and attributes.

 Data sets is the collection of Attributes

data objects and their
attributes
Tid Refund Marital Taxable
Status Income Cheat
 An attribute is a property or
characteristic of an object 1 Yes Single 125K No
 Examples: eye color of a 2 No Married 100K No
person, temperature, etc. 3 No Single 70K No

Objects
 Attribute is also known
4 Yes Married 120K No
as variable, field,
5 No Divorced 95K Yes
characteristic,
dimension, or feature 6 No Married 60K No
 A collection of attributes 7 Yes Divorced 220K No
describe an object 8 No Single 85K Yes
 Object is also known as 9 No Married 75K No
record, point, case, 10 No Single 90K Yes
sample, entity, or 10

instance
 Attribute Values
 Attribute values are numbers or symbols assigned to an
attribute for a particular object

 Distinction between attributes and attribute values

 Same attribute can be mapped to different attribute

values
 Example: height can be measured in feet or meters

 Different attributes can be mapped to the same set of

values
 Example: Attribute values for ID and age are

integers
 But properties of attribute values can be different
 Attributes
 Types:
 Nominal
 Binary
 Numeric: quantitative
 Interval-scaled

 Ratio-scaled

12
 Attribute Types
 Nominal: categories, states, or “names of things”
 Hair_color = {auburn, black, blond, brown, grey, red, white}
 marital status, occupation, ID numbers, zip codes
 Binary
 Nominal attribute with only 2 states (0 and 1)
 Symmetric binary: both outcomes equally important
 e.g., gender
 Asymmetric binary: outcomes not equally important.
 e.g., medical test (positive vs. negative)
 Convention: assign 1 to most important outcome (e.g., HIV
positive)
 Ordinal
 Values have a meaningful order (ranking) but magnitude between
successive values is not known.
 Size = {small, medium, large}, grades, Professional rankings
13
 Numeric Attribute Types
 Quantity (integer or real-valued)
 Interval
 Measured on a scale of equal-sized units
 Values have order
 E.g., temperature in C˚or F˚, calendar dates
 No true zero-point
 Ratio
 Inherent zero-point
 We can speak of values as being an order of magnitude
larger than the unit of measurement (10 K˚ is twice as
high as 5 K˚).
 e.g., temperature in Kelvin, years of experience(e.g., the
objects are employees) and number of words (e.g., the objects
are documents),length, counts, monetary quantities

14
 Discrete vs. Continuous
Attributes
 Discrete Attribute
 Has only a finite or countably infinite set of values

 E.g., zip codes, profession, or the set of words in a

collection of documents
 Sometimes, represented as integer variables

 Note: Binary attributes are a special case of discrete

attributes
 Continuous Attribute
 Has real numbers as attribute values

 E.g., temperature, height, or weight

 Continuous attributes are typically represented as

floating-point variables

15
 Properties of Attribute Values
 The type of an attribute depends on which of the
following properties/operations it possesses:

Distinctness: = 

Order: < >

Differences are + -
meaningful :

Ratios are * /
meaningful
 Nominal attribute: distinctness
 Ordinal attribute: distinctness & order
 Interval attribute: distinctness, order & meaningful
differences
 Ratio attribute: all 4 properties/operations
 Discrete and Continuous
Attributes
 Discrete Attribute
 Has only a finite or countably infinite set of values
 Examples: zip codes, counts, or the set of words in a
collection of documents
 Often represented as integer variables.
 Note: binary attributes are a special case of discrete
attributes
 Continuous Attribute
 Has real numbers as attribute values
 Examples: temperature, height, or weight.
 Practically, real values can only be measured and represented
using a finite number of digits.
 Continuous attributes are typically represented as floating-
point variables.
 Types of data sets

 Record
 Data Matrix
 Document Data
 Transaction Data

 Graph
 World Wide Web
 Molecular Structures

 Ordered
 Spatial Data
 Temporal Data
 Sequential Data
 Genetic Sequence Data
 Record Data
 Data that consists of a collection of records,
each of which consists of a fixed set of
attributes

Tid Refund Marital Taxable

Status Income Cheat

1 Yes Single 125K No

2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes
10
 Data Matrix
 If data objects have the same fixed set of numeric
attributes, then the data objects can be thought of as
points in a multi-dimensional space, where each
dimension represents a distinct attribute

 Such a data set can be represented by an m by n

matrix, where there are m rows, one for each object,
and n columns, one for each attribute

Projection Projection Distance Load Thickness

of x Load of y load

10.23 5.27 15.22 2.7 1.2

12.65 6.25 16.22 2.2 1.1
 Document Data
 Each document becomes a ‘term’ vector
 Each term is a component (attribute) of the vector
 The value of each component is the number of times
the corresponding term occurs in the document.

timeout

season
coach

game
score
play
team

win
ball

lost
Document 1 3 0 5 0 2 6 0 2 0 2

Document 2 0 7 0 2 1 0 0 3 0 0

Document 3 0 1 0 0 1 2 2 0 3 0
 Transaction Data
 A special type of data, where
 Each transaction involves a set of items.
 For example, consider a grocery store. The set of
products purchased by a customer during one
shopping trip constitute a transaction, while the
individual products that were purchased are the
items.
 Can represent transaction data as record data

TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
 Graph Data
 Examples: Generic graph, a molecule, and
webpages

2
5 1
2
5

Benzene Molecule: C6H6

 Ordered Data
 Sequences of transactions
Items/Events

An element
of the
sequence
 Ordered Data
 Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCC
CGCAGGGCCCGCCCCGCGCCGTC
GAGAAGGGCCCGCCTGGCGGGCG
GGGGGAGGCGGGGCCGCCCGAGC
CCAACCGAGTCCGACCAGGTGCC
CCCTCTGCTCGGCCTAGACCTGA
GCTCATTAGGCGGCAGCGGACAG
GCCAAGTAGAACACGCGAAGCGC
TGGGCTGCCTGCTGCGACCAGGG
 Ordered Data
 Spatio-Temporal Data

Average Monthly
Temperature of
land and ocean
 Example: A Web Mining Framework

 Web mining usually involves

 Data cleaning
 Data integration from multiple sources
 Warehousing the data
 Data cube construction
 Data selection for data mining
 Data mining
 Presentation of the mining results
 Patterns and knowledge to be used or stored into
knowledge-base

27
 Data Mining in Business Intelligence

Increasing potential
to support
business decisions End User
Decision
Making

Data Presentation Business

Analyst
Visualization Techniques
Data Mining Data
Information Discovery Analyst

Data Exploration
Statistical Summary, Querying, and Reporting

Data Preprocessing/Integration, Data Warehouses

DBA
Data Sources
Paper, Files, Web documents, Scientific experiments, Database Systems
28
Example: Mining vs. Data Exploration

 Business intelligence view

 Warehouse, data cube, reporting but not much mining
 Business objects vs. data mining tools
 Supply chain example: tools
 Data presentation
 Exploration

29
 KDD Process: A Typical View from ML and
Statistics

Input Data Data Pre- Data Post-

Processing Mining Processing

Data integration Pattern discovery Pattern evaluation

Normalization Association & correlation Pattern selection
Feature selection Classification Pattern interpretation
Clustering
Dimension reduction Pattern visualization
Outlier analysis
…………

 This is a view from typical machine learning and statistics communities

30
 Example: Medical Data Mining

 Health care & medical data mining – often

adopted such a view in statistics and machine
learning
 Preprocessing of the data (including feature
extraction and dimension reduction)
 Classification or/and clustering processes
 Post-processing for presentation

31
 Chapter 1. Introduction
 Why Data Mining?
 What Is Data Mining?
 A Multi-Dimensional View of Data Mining
 What Kind of Data Can Be Mined?
 What Kinds of Patterns Can Be Mined?
 What Technology Are Used?
 What Kind of Applications Are Targeted?
 Major Issues in Data Mining
 A Brief History of Data Mining and Data Mining Society
 Summary
32
 Multi-Dimensional View of Data Mining
 Data to be mined
 Database data (extended-relational, object-oriented, heterogeneous,

legacy), data warehouse, transactional data, stream, spatiotemporal,

time-series, sequence, text and web, multi-media, graphs & social
and information networks
 Knowledge to be mined (or: Data mining functions)
 Characterization, discrimination, association, classification, clustering,

trend/deviation, outlier analysis, etc.

 Descriptive vs. predictive data mining

 Multiple/integrated functions and mining at multiple levels

 Techniques utilized
 Data-intensive, data warehouse (OLAP), machine learning, statistics,

pattern recognition, visualization, high-performance, etc.

 Applications adapted
 Retail, telecommunication, banking, fraud analysis, bio-data mining,

stock market analysis, text mining, Web mining, etc.

33
 Chapter 1. Introduction
 Why Data Mining?
 What Is Data Mining?
 A Multi-Dimensional View of Data Mining
 What Kind of Data Can Be Mined?
 What Kinds of Patterns Can Be Mined?
 What Technology Are Used?
 What Kind of Applications Are Targeted?
 Major Issues in Data Mining
 A Brief History of Data Mining and Data Mining Society
 Summary
34
 Data Mining: On What Kinds of Data?
 Database-oriented data sets and applications
 Relational database, data warehouse, transactional database
 Advanced data sets and advanced applications
 Data streams and sensor data
 Time-series data, temporal data, sequence data (incl. bio-sequences)
 Structure data, graphs, social networks and multi-linked data
 Object-relational databases
 Heterogeneous databases and legacy databases
 Spatial data and spatiotemporal data
 Multimedia database
 Text databases
 The World-Wide Web

35
 Chapter 1. Introduction
 Why Data Mining?
 What Is Data Mining?
 A Multi-Dimensional View of Data Mining
 What Kind of Data Can Be Mined?
 What Kinds of Patterns Can Be Mined?
 What Technology Are Used?
 What Kind of Applications Are Targeted?
 Major Issues in Data Mining
 A Brief History of Data Mining and Data Mining Society
 Summary
36
Data Mining Function: (1) Generalization
 Information integration and data warehouse construction
 Data cleaning, transformation, integration, and
multidimensional data model
 Data cube technology
 Scalable methods for computing (i.e., materializing)
multidimensional aggregates
 OLAP (online analytical processing)
 Multidimensional concept description: Characterization
and discrimination
 Generalize, summarize, and contrast data
characteristics, e.g., dry vs. wet region

37
 Data Mining Function: (2) Association
and Correlation Analysis
 Frequent patterns (or frequent itemsets)
 What items are frequently purchased together in your
Walmart?
 Association, correlation vs. causality
 A typical association rule
 Diaper  Beer [0.5%, 75%] (support, confidence)
 Are strongly associated items also strongly correlated?
 How to mine such patterns and rules efficiently in large
datasets?
 How to use such patterns for classification, clustering,
and other applications?
38
Data Mining Function: (3) Classification

 Classification and label prediction

 Construct models (functions) based on some training examples
 Describe and distinguish classes or concepts for future prediction
 E.g., classify countries based on (climate), or classify cars
based on (gas mileage)
 Predict some unknown class labels
 Typical methods
 Decision trees, naïve Bayesian classification, support vector
machines, neural networks, rule-based classification, pattern-
based classification, logistic regression, …
 Typical applications:
 Credit card fraud detection, direct marketing, classifying stars,
diseases, web-pages, …

39
Data Mining Function: (4) Cluster Analysis

 Unsupervised learning (i.e., Class label is unknown)

 Group data to form new categories (i.e., clusters), e.g.,
cluster houses to find distribution patterns
 Principle: Maximizing intra-class similarity & minimizing
interclass similarity
 Many methods and applications

40
Data Mining Function: (5) Outlier Analysis
 Outlier analysis
 Outlier: A data object that does not comply with the general
behavior of the data
 Noise or exception? ― One person’s garbage could be another
person’s treasure
 Methods: by product of clustering or regression analysis, …
 Useful in fraud detection, rare events analysis

41
Time and Ordering: Sequential Pattern,
Trend and Evolution Analysis
 Sequence, trend and evolution analysis
 Trend, time-series, and deviation analysis: e.g., regression

and value prediction

 Sequential pattern mining

 e.g., first buy digital camera, then buy large SD memory

cards
 Periodicity analysis

 Motifs and biological sequence analysis

 Approximate and consecutive motifs

 Similarity-based analysis

 Mining data streams

 Ordered, time-varying, potentially infinite, data streams

42
 Structure and Network Analysis
 Graph mining
 Finding frequent subgraphs (e.g., chemical compounds), trees

(XML), substructures (web fragments)

 Information network analysis
 Social networks: actors (objects, nodes) and relationships (edges)

 e.g., author networks in CS, terrorist networks

 Multiple heterogeneous networks

 A person could be multiple information networks: friends,

family, classmates, …
 Links carry a lot of semantic information: Link mining

 Web mining
 Web is a big information network: from PageRank to Google

 Analysis of Web information networks

 Web community discovery, opinion mining, usage mining, …

43
 Chapter 1. Introduction
 Why Data Mining?
 What Is Data Mining?
 A Multi-Dimensional View of Data Mining
 What Kind of Data Can Be Mined?
 What Kinds of Patterns Can Be Mined?
 What Technology Are Used?
 What Kind of Applications Are Targeted?
 Major Issues in Data Mining
 A Brief History of Data Mining and Data Mining Society
 Summary
44
Data Mining: Confluence of Multiple Disciplines

Machine Pattern Statistics

Learning Recognition

Applications Data Mining Visualization

Algorithm Database High-Performance

Technology Computing

45
Why Confluence of Multiple Disciplines?
 Tremendous amount of data
 Algorithms must be highly scalable to handle such as tera-bytes of
data
 High-dimensionality of data
 Micro-array may have tens of thousands of dimensions
 High complexity of data
 Data streams and sensor data
 Time-series data, temporal data, sequence data
 Structure data, graphs, social networks and multi-linked data
 Heterogeneous databases and legacy databases
 Spatial, spatiotemporal, multimedia, text and Web data
 Software programs, scientific simulations
 New and sophisticated applications
46
 Chapter 1. Introduction
 Why Data Mining?
 What Is Data Mining?
 A Multi-Dimensional View of Data Mining
 What Kind of Data Can Be Mined?
 What Kinds of Patterns Can Be Mined?
 What Technology Are Used?
 What Kind of Applications Are Targeted?
 Major Issues in Data Mining
 A Brief History of Data Mining and Data Mining Society
 Summary
47
 Applications of Data Mining
 Web page analysis: from web page classification, clustering to
PageRank & HITS algorithms
 Collaborative analysis & recommender systems
 Basket data analysis to targeted marketing
 Biological and medical data analysis: classification, cluster analysis
(microarray data analysis), biological sequence analysis, biological
network analysis
 Data mining and software engineering (e.g., IEEE Computer, Aug.
2009 issue)
 From major dedicated data mining systems/tools (e.g., SAS, MS SQL-
Server Analysis Manager, Oracle Data Mining Tools) to invisible data
mining

48
 Chapter 1. Introduction
 Why Data Mining?
 What Is Data Mining?
 A Multi-Dimensional View of Data Mining
 What Kind of Data Can Be Mined?
 What Kinds of Patterns Can Be Mined?
 What Technology Are Used?
 What Kind of Applications Are Targeted?
 Major Issues in Data Mining
 A Brief History of Data Mining and Data Mining Society
 Summary
49
 Major Issues in Data Mining (1)

 Mining Methodology
 Mining various and new kinds of knowledge
 Mining knowledge in multi-dimensional space
 Data mining: An interdisciplinary effort
 Boosting the power of discovery in a networked environment
 Handling noise, uncertainty, and incompleteness of data
 Pattern evaluation and pattern- or constraint-guided mining
 User Interaction
 Interactive mining
 Incorporation of background knowledge
 Presentation and visualization of data mining results

50
 Major Issues in Data Mining (2)

 Efficiency and Scalability

 Efficiency and scalability of data mining algorithms
 Parallel, distributed, stream, and incremental mining methods
 Diversity of data types
 Handling complex types of data
 Mining dynamic, networked, and global data repositories
 Data mining and society
 Social impacts of data mining
 Privacy-preserving data mining
 Invisible data mining

51
 Chapter 1. Introduction
 Why Data Mining?
 What Is Data Mining?
 A Multi-Dimensional View of Data Mining
 What Kind of Data Can Be Mined?
 What Kinds of Patterns Can Be Mined?
 What Technology Are Used?
 What Kind of Applications Are Targeted?
 Major Issues in Data Mining
 A Brief History of Data Mining and Data Mining Society
 Summary
52
 Summary
 Data mining: Discovering interesting patterns and knowledge from
massive amount of data
 A natural evolution of database technology, in great demand, with
wide applications
 A KDD process includes data cleaning, data integration, data
selection, transformation, data mining, pattern evaluation, and
knowledge presentation
 Mining can be performed in a variety of data
 Data mining functionalities: characterization, discrimination,
association, classification, clustering, outlier and trend analysis, etc.
 Data mining technologies and applications
 Major issues in data mining

53