Genetic codon

• A sequence of 3 Nucleotides in mRNA that

codes for one amino acid
Eg. AUG→ methionine
• A collection of all genetic codons is called
Genetic code
• With four bases, a total of 64 triplet codons
is possible
• Three are 3 stop codons: UAG ,UAA, UGA
(signal the stop of protein synthesis)
• Hence, 61 codons for 20 amino acids
 Features of the genetic code

1. Specific
• Explain: A specific sequence of 3 nucluetides
(codons) could code for one AA.
 Features of the genetic code
2. Universal
• Explain: No matter in what organism the
mRNA is being translated, it will express the
same aa
 Features of the genetic code
3. Redundant/degenerate
• Explain: More than one triplet can code for
the same aa

Eg. Phe has 2 codons

Ile has 3 codons
Ala has 4 codons
Leu has 6 codons
 Features of the genetic code
4. Non-overlapping
• Explain: each base is only a part of one codon
UCGGUACAGAAUCCAACAGAAUCCGGUACA
Codon 3
Codon 2
Codon 1
This is the Wrong (wrong/correct) reading
pattern

UCGGUACAGAAUCCAACAGAAUCCGGUACA
Codon 1 Codon 2 Codon 3

This is the Right (wrong/correct) reading pattern

 Features of the genetic code
5. Commaless
• Explain: No base is wasted for Punctuation
UCGGUACAGAAUCCAACAGAAUCCGGUACA
Codon 1 Codon 2 Codon 3

This is the wrong (wrong/correct) reading pattern

UCGGUACAGAAUCCAACAGAAUCCGGUACA
Codon 1 Codon 2 Codon 3

This is the correct (wrong/correct) reading

 Translation

• The process of protein synthesis

• The process of TRANSLATING the nucleic
acid language of mRNA to the aa language of
proteins
 Steps in prokaryotic translation
1. Activation
2. Initiation
3. Elongation
4. Termination
 1. Activation
• Amino acids are attached to the A of the CCA
sequence at the 3’ end of tRNA
• The product is called amino acyl tRNA or charged
tRNA’
• This process activates both the amino acid and
the tRNA
• Enzyme for activation is aminoacyl tRNA
synthetase ( aaRS)
• There is one amino acyl synthetase enzyme for
each amino acid
 1. Activation (contd.)
• Each enzyme recognizes a specific aa as well as its
isoaccepting tRNA All the tRNA that correspond to that
aa
• Activation is ATP dependent
• Extreme specificity and the proofreading ability of
the enzyme ensures fidelity of translation
• Proofreading activity of the enzyme helps in
removal of mischarged amino acids from the
enzyme or the tRNA
• The initiator tRNA is first charged with methionine
which is later converted to N-formyl methionine by
transformylase (N10 formyl THF is the cofactor)
 2. Initiation
• Involves the assembly of the two ribosome
subunits, the mRNA, the initiator tRNA with the
first amino acid (N-formyl methionine)
• Initiation is aided by proteins called initiation
factors (3 in number : 1, 2 & 3)
• Initiation is GTP dependent for energy
• Ribosome in prokaryotes is a 70s ribosome.
Made up of 2 subunits, 50s and 30s.
– 50s subunit is made of 23 s rRNA, 5s rRNA and
31 proteins
– 30s subunit has 16 s rRNA & 21 ribosomal proteins
 2. Initiation (contd.)
• mRNA has a consensus sequence of purine
rich nucleotide bases located 6-10 bases
upstream of the start codon, called Shine
Dalgarano sequence
• 16 s rRNA (component of the small ribosomal
unit) has a nucleotide sequence at its 3’end
complementary to Shine Dalgarno sequence
 2. Initiation (contd.)
• First step of initiation involves binding of the
mRNA (AUG) to small (30s) subunit of ribosome
– Shine Dalgarno sequence binds to the 16s rRNA
at the 3’ end. This facilitates proper positioning
of the small rRNA (30s) on the mRNA so that
translation can accurately begin on start codon
AUG
• Next, the charged initiator tRNA recognises the
start codon. The anti-codon of tRNA binds
antiparallel to the codon on mRNA

Bacteria: N-formyl methionine eukaryotes: methionine

 2. Initiation (contd.)
• The 50 s subunit binds to this complex to
form a complete ribosome as a part of the
initiation complex
• The complete ribosome has 3 sites : E (Exit
site), P (peptidyl site) and A (aminoacyl site)
– Uncharged tRNA leaves the ribosome from
the E site
– All new tRNAs bind to the ribosome at the A
site (except the initiator tRNA which binds at
the P site)
 2. Initiation (contd.)
– tRNA with the growing peptide is bound to
the P site
• Initiation is complete with the formation of
the initiation complex
• Initiation complex enters the next stage -
Elongation
 3. Elongation
• The next tRNA with the next amino acid binds
to the A site of the ribosomal complex.
• The enzyme peptidyltransfarase transfers the
first amino acid from the initiating tRNA on P
site to form a peptide bond with the amino
acid on the next tRNA on the A site
• Now the tRNA on P-site is empty tRNAand
that on A-site carries a peptide tRNA
• The whole ribosome moves along the mRNA
towards the 3’ end by a distance of one
codon. This process is called Translocation
 3. Elongation
• Now the E site has the uncharged-tRNA, P site has
the Peptidyl-tRNA and A site is ready to accept the
next tRNA with the next amino acid. The steps of
elongation repeat to elongate the peptide chain
• Elongation is aided by proteins called Elongation
factors (3 in number: EF tu, EF Ts and EF G)
• Elongation is GTP dependent for energy
• Elongation continues till A site falls on a STOP
codon
 4. Termination
• Termination begins when one of the STOP codons
occupies the A site
• Instead of a tRNA, proteins called release factor
bind to the stop codon (RF-1 recognises UAA and
UAG, RF-2 recognises UGA and UAA)
• Peptidyl transferase hydrolyses the bond
between the peptide chain and the tRNA,
releasing the peptide chain free
• RF-3 GTP causes the release of RF-1 and RF-2
• The ribosomal subunits, the mRNA and the
empty tRNA dissociate from each other
 Eukaryotic translation
• Similar to prokaryotic translation, with the
following differences:
• The initiator tRNA carries methionine, not N-formyl
methionine, to the P-site
• Initiation factors are 10 in number ( eIF 1-10)
• Ribosomes are 80 s with 60 and 40 subunits
– 60s subunit is made up of 28 rRNA, 5 rRNA, 5.8
rRNA and 50 proteins
– 40s subunit is made up of 18 rRNA and 30 proteins
• mRNA is monocistronic (polycistronic in prokaryotes)
 Eukaryotic translation (contd.)
• No Shine Dalgarno sequence. 40s subunit, aided
by eIFs, binds to the 5’ cap and slides down the
mRNA to reach the start codon
• Elongation factors are EF-1 alpha- GTP, EF-1
beta-gamma and EF 2 instead of EF-Tu, EF-Ts
and EF-G respectively
• A single release factor, eRF 1, functions to
recognise all stop codons. Another release
factor eRF-3 functions to release of eRF
 Post translational modification
• Changes taking place in the polypeptide chain
after translation
• Essential to convert the new polypeptide to
functional protein
 Post translational modification
• Removal of N-terminal signal sequence
(Eg. Conversion of preproprotein to proprotein)
• Removal of some amino terminal, carboxy
terminal or internal amino acids
(Eg. Removal of C-peptide during in insulin)
• Hydroxylation of serine/threonine/tyrosine
residues (Eg.Collagen synthesis)
• Glycosylation of amino acids
(Eg.Collagen synthesis)
 Post translational modification
• Gamma-carboxylation of glutamate
(Eg. Maturation of clotting factors)
• Phosphorylation of tyrosine residues
(Eg. Covalent modification of glycogen
phosphorylase)
• Addition of cofactors
(Eg. Heme to globin chains)
 Inhibitors of translation
1. Tetracyclines: bind to 30s ribosomal subunit
of bacteria, inhibits bacterial protein
synthesis; used as an antibiotic
2. Chloramphenicol: Inhibits peptidyl
transferase activity in bacteria; inhibits
bacterial protein synthesis; used as an
antibiotic
3. Erythromycin & Clindamycin: Inhibit bacterial
translocation; inhibits bacterial protein
synthesis; used as an antibiotic
 Inhibitors of translation
4. Streptomycin: bind to 30s ribosomal subunit of
bacteria, inhibits bacterial protein synthesis;
used as an antibiotic
5. Puromycin: structurally similar to tyrosinyl
tRNA; inhibits prokaryotic & eukaryotic protein
synthesis by attaching to A-site of ribosome
6. Diphtheria toxin: Inactivates elongation factor in
mammalian cells; inhibits mammalian protein
synthesis
7. Cycloheximide: Inhibits eukaryotic peptidyl
transferase; inhibits only eukaryotic protein
synthesis