Add

AI
to your business
The speaker
• Devesh Rajadhyax
Co-founder and CEO, Cere Labs
• M.Tech (Control Systems)
• 22+ years IT
• 20+ years entrepreneur
• 16 years Healthcare Informatics
• 5+ years AI
• Research – Knowledge Based
Systems, Cognitive Computing

© Cere Labs Pvt. Ltd. 2

As students of business management
• You will be handling a major disruption
• A new wave of technology is hitting the companies across the globe
• Artificial Intelligence
• IoT
• Big Data
• Blockchain
• AR/VR
• Robotics
• You are either the disrupter or the disrupted, there are no neutral nations

© Cere Labs Pvt. Ltd. 3

AI Lifecycle in a company
• Awareness
• Problem Statement Identification
• PoC
• Implementation
• Learning
• Next Problem Statement identification

© Cere Labs Pvt. Ltd. 4

This Workshop (Awareness phase begins…)
• Objectives
• Introduction to AI
• Understand Digital Systems landscape
• To learn a framework for problem statement identification
• To do some use case analysis first hand
• Introduction to AI techniques – Data Science, Machine Learning, Deep Learning,
Computer Vision
• Learn the terminology

• Outcome
• To be able to conduct analysis of AI landscape in own organization
• Identification of top problem statements

© Cere Labs Pvt. Ltd. 5

Introduction to AI
Phase 1

6 © Cere Labs Pvt. Ltd.

What is AI?
• AI is the pursuit of imitating human capabilities

Human capabilities

Perception Computation and memory

Action

© Cere Labs Pvt. Ltd. 7

AI application areas
• Senses • Motors • Computing
• Speech recognition • Robotics • Predictive Analytics
• Computer vision • Natural language • Anomaly Detection
• Natural language generation • Planning and
processing • Text to speech reasoning
• Writing recognition • Conversation • Decisions
• Pattern recognition

© Cere Labs Pvt. Ltd. 8

Examples - senses
• Speech recognition
• Siri, Google Assistant, Alexa
• Computer vision (video)
• Natural language processing
• Chatbots (video)
• Summarisation
• Translation
• Writing recognition
• Prescription processing
• Invoice processing (video)
© Cere Labs Pvt. Ltd. 9
Examples - motor
• Robotics
• Autonomous car
• House robots
• Drones
• Speech generation
• Alexa
• Conversation
• Chatbots

© Cere Labs Pvt. Ltd. 10

Examples – computation and memory
• Prediction
• Sales forecast
• Demand forecast
• Anomaly
• Fraud detection
• Disease detection
• Reasoning
• Chess programs
• Expert systems

© Cere Labs Pvt. Ltd. 11

Well known use cases

12 © Cere Labs Pvt. Ltd.

Recommendation engines

© Cere Labs Pvt. Ltd. 13

Demand forecasting

© Cere Labs Pvt. Ltd. 14

Failure prediction

© Cere Labs Pvt. Ltd. 15

Customer behavior

© Cere Labs Pvt. Ltd. 16

Computational biology

GGCAGATTCCCCCTAGACCCGCCCGCACCATGGTCAGGCATGCCCCTCCTCATCGCTGGGCACAGCC
CAGAGGGTATAAACAGTGCTGGAGGCTGGCGGGGCAGGCCAGCTGAGTCCTGAGCAGCAGCCCA
GCGCAGCCACCGAGACACCATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGC
ATCGCTGGCCAGGCAGGTGAGTGCCCCCACCTCCCCTCAGGCCGCATTGCAGTGGGGGCTGAGAG
GAGGAAGCACCATGGCCCACCTCTTCTCACCCCTTTGGCTGGCAGTCCCTTTGCAGTCTAACCACCT
TGTTGCAGGCTCAATCCATTTGCCCCAGCTCTGCCCTTGCAGAGGGAGAGGAGGGAAGAGCAAGC
TGCCCGAGACGCAGGGGAAGGAGGATGAGGGCCCTGGGGATGAGCTGGGGTGAACCAGGCTCCC
TTTCCTTTGCAGGTGCGAAGCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGGTATGAGGATGGAC
CTGATGGGTTCCTGGACCCTCCCCTCTCACCCTGGTCCCTCAGTCTCATTCCCCCACTCCTGCCACCTC
CTGTCTGGCCATCAGGAAGGCCAGCCTGCTCCCCACCTGATCCTCCCAAACCCAGAGCCACCTGATG
CCTGCCCCTCTGCTCCACAGCCTTTGTGTCCAAGCAGGAGGGCAGCGAGGTAGTGAAGAGACCCA
GGCGCTACCTGTATCAATGGCTGGGGTGAGAGAAAAGGCAGAGCTGGGCCAAGGCCCTGCCTCTC
CGGGATGGTCTGTGGGGGAGCTGCAGCAGGGAGTGGCCTCTCTGGGTTGTGGTGGGGGTACAGG
CAGCCTGCCCTGGTGGGCACCCTGGAGCCCCATGTGTAGGGAGAGGAGGGATGGGCATTTTGCAC
GGGGGCTGATGCCACCACGTCGGGTGTCTCAGAGCCCCAGTCCCCTACCCGGATCCCCTGGAGCCC
AGGAGGGAGGTGTGTGAGCTCAATCCGGACTGTGACGAGTTGGCTGACCACATCGGCTTTCAGGA
GGCCTATCGGCGCTTCTACGGCCCGGTCTAGGGTGTCGCTCTGCTGGCCTGGCCGGCAACCCCAGTT
CTGCTCCTCTCCAGGCACCCTTCTTTCCTCTTCCCCTTGCCCTTGCCCTGACCTCCCAGCCCTATGGAT
GTGGGGTCCCCATCATCCCAGCTGCTCCCAAATAAACTCCAGAAG

© Cere Labs Pvt. Ltd. 17

Benefits of AI to humankind

18 © Cere Labs Pvt. Ltd.

More utilization of resources

Autonomous car
© Cere Labs Pvt. Ltd. 19
Repositioning of human efforts

Cooking robot

© Cere Labs Pvt. Ltd. 20

Fairness

Evaluation and selection

© Cere Labs Pvt. Ltd. 21

Care and companionship

Conversation

© Cere Labs Pvt. Ltd. 22

History and state of play

23 © Cere Labs Pvt. Ltd.

© Cere Labs Pvt. Ltd. 24
AI Timeline
1950-60s
Rule based, logic, mathematical 1997
Deep Blue defeats Kasparov
1980-early 90s
Knowledge based expert systems
Neural Networks 2010
Siri
2000-2010
Robots, Autonomous Vehicles, 2011
Speech, Predictive Analytics Watson wins Jeopardy

2010-2019 2014
Deep Learning, Reinforcement Learning Deepmind

© Cere Labs Pvt. Ltd. 25

Why AI now?

Computing power
Internet

Huge data

© Cere Labs Pvt. Ltd. 26

Where AI is now?
• ANI, AGI and ASI
• Singularity
• Threat to humankind

© Cere Labs Pvt. Ltd. 27

AI in Business
Phase 2

28 © Cere Labs Pvt. Ltd.

AI and the digital transformation
• AI is the central technology in digital transformation of a business

• Digital transformation is imperative for every business to

• Protect from being disrupted
• Achieve leadership position

© Cere Labs Pvt. Ltd. 29

Digital and IT
• How are digital systems different from IT systems?
• They have many things in commons
• Major difference - digital systems work with
• Real world input
• Handle problems that are not well defined
• Their action has direct impact on real world
• Data plays a very big role in digital systems
• The technologies that make up digital system are evolving very fast

© Cere Labs Pvt. Ltd. 30

Digital Technology Landscape

Inputs AI, IoT

Outputs AI, Robotics, VR/AR
Storage and management Cloud, Big Data, Blockchain
Processing AI, Big Data

© Cere Labs Pvt. Ltd. 31

Central role of AI
• AI plays an important role in digital systems
• Input, processing and output all need AI to deal with real world data
• Computing methods in AI such as machine learning are based on
available data, this making it perfectly suitable for real world
problems.

© Cere Labs Pvt. Ltd. 32

Implementing AI in your company
• Four aspects that will help you to get started on AI journey
• Data
• Technology
• Objectives
• Possibilities (or applications)

• They form the DTOP framework for AI Use Case Analysis

© Cere Labs Pvt. Ltd. 33

DTOP Framework

Data

Possibilities

Problem statements

Technology Objectives

© Cere Labs Pvt. Ltd. 34

Data
• Structured
• Database, spreadsheets
• Unstructured
• Invoices, emails
• Dark
• Video, handwriting, speech

© Cere Labs Pvt. Ltd. 35

Technology
• Machine Learning
• Deep Learning
• Natural Language Processing
• Bayesian Networks
• Image Processing
• Logic methods

© Cere Labs Pvt. Ltd. 36

Objectives
• Motivations: to grow, to achieve leadership
• Pain areas: Delays, leakages, monotonous work

• Areas: customer satisfaction, sales, innovation, employee

satisfaction, cost saving

• Scope: Department, organization wide

© Cere Labs Pvt. Ltd. 37

Possibilities
• Analytics
• Descriptive
• Prescriptive
• Diagnostic
• Predictive
• Automation
• Knowledge

© Cere Labs Pvt. Ltd. 38

Predictive Analytics (Credit Card Fraud Detection)
Phase 3

39 © Cere Labs Pvt. Ltd.

Machine learning: What is it?
• Guess the relationship in this sequence

Input Output
0 0
2 4
3 ?

© Cere Labs Pvt. Ltd. 40

Machine learning: What is it?
• New data added
Input Output
0 0
2 4
3 9
4 ?

© Cere Labs Pvt. Ltd. 41

Machine learning: What is it?
• Learning and understanding the pattern in data Eg: shape, color,
size

• ML-Algorithms find natural
patterns within the data, get
insights and predict the
unknown for better decisions.

• Machine learning differs from

conventional programming

© Cere Labs Pvt. Ltd. 42

Machine learning: How does it work?

© Cere Labs Pvt. Ltd. 43

Credit card fraud detection
• D : Data: Structured data
• Card holder’s information
• Transaction information
• T: Technology: Machine learning – Supervised Learning
• O: Objective: Customer experience, Cost saving
• P: Possibility: Predictive Analytics – Classifying transactions as
Fraud / Not fraud

© Cere Labs Pvt. Ltd. 44

Machine learning:
Credit card fraud detection use case
• Data challenges
• Enough data
• Skewed data
• Un-sanitized data

• Pre-processing
• Normalization
• Empty values
• Feature engineering
• Dimension reduction
• Categorical data
• Combining data

© Cere Labs Pvt. Ltd. 45

Machine learning: Overview of types
• Supervised
• Classification
• Regression

• Un supervised
• Clustering

© Cere Labs Pvt. Ltd. 46

Machine learning: Model validation
• Accuracy
Actual Predicted Remarks
Normal Normal Model worked well
Fraud Fraud Model worked well
Normal Fraud Mistake but less sensitive
Fraud Normal Serious error

• Re-training of the model if necessary

• Problem of over-fitting

© Cere Labs Pvt. Ltd. 47

Deep Learning (Crop Health)
Phase 3

48 © Cere Labs Pvt. Ltd.

Machine Learning v/s Deep Learning

Math’s and stats Human brain

© Cere Labs Pvt. Ltd. 49

Imitating the brain

Human Neuron Artificial Neuron

© Cere Labs Pvt. Ltd. 50

Artificial Neural Network

© Cere Labs Pvt. Ltd. 51

The Matrix

Vector transformation

W x = y

© Cere Labs Pvt. Ltd. 52

The compositional world

© Cere Labs Pvt. Ltd. 53

Multilayer neural networks

© Cere Labs Pvt. Ltd. 54

Convolutional neural networks (CNNs)

© Cere Labs Pvt. Ltd. 55

Recurrent neural networks (RNNs)

© Cere Labs Pvt. Ltd. 56

Applications

© Cere Labs Pvt. Ltd. 57

Crop health status identification
• D : Data: Dark data
• Pictures of crop
• Expert opinion on crop diseases / conditions
• T: Technology: Deep learning – CNN
• O: Objective: Cost saving
• P: Possibility: Predictive Analytics (Multi variate classification ) –
Classifying crop as Healthy / Leaf Blight / Black Rot etc

© Cere Labs Pvt. Ltd. 58

Exercise in use case analysis
Phase 4

59 © Cere Labs Pvt. Ltd.

Thanks
Contact:
Devesh Rajadhyax
CEO, Cere Labs Pvt. Ltd.
devesh.rajadhyax@cerelabs.com
Rajashree Rajadhyax
COO, Cere Labs Pvt. Ltd.
rajashree.rajadhyax@cerelabs.com