Professional Documents
Culture Documents
Ginseng
Ginseng
Ginseng
Meyer
E EMetabolic Engineering of Ginsenoside Biosynthetic Pathway for the Enhanced Production of Oleanane-type Ginsenoside [Ro] in Panax ginseng C. A. Meyer
Metabolic Engineering of Ginsenoside Biosynthetic Pathway for the Enhanced Production of Oleanane-type Ginsenoside [Ro] in Panax ginseng C. A. Meyer
The main biologically active constituents in P. ginseng are the complex mixture of triterpene saponins known as Ginsenosides (Rx). These are found only in the four-year-old roots. These ginsenosides are synthesized via Isoprenoid pathway. With the exception of Ginsenoside Ro, which is an oleanane-type triterpenoid, all ginsenosides are the dammarane-type separated into panaxadiol and panaxatriol classes. -amyrin synthase [AS] is the key enzyme involved in oleanane-type ginsenoside [Ro] biosynthesis.
Medicinal properties of Oleanane-type ginsenosides [Ro] Anti-platelet aggregation Fibrinolytic action Stimulation of phagocytic action Anti-hepatic activity Anti-inflammatory activity Anti-tumor activity Anti-oxidant activity
Isoprenoid Pathway
Heterologous expression studies of -amyrin synthase cDNA in E. coli BL21 DE3 pLys S
vCloning of -amyrin synthase cDNA into pRSET A expression vector and subsequent transformation into E. coli BL21 DE3 pLys S vIPTG-induced expression of -amyrin synthase cDNA v vRecombinant -amyrin synthase purification using Ni-NTA columns vPolyclonal antibodies in rabbits vIn vitro -amyrin synthase assay vCrystallographic studies of recombinant -amyrin synthase
1 2 3 4 5 6 7 8 9 10 1112 13 14 15 16 17 18 19
r 1h
r 2h
r r N 3h O/ 1h
r 2h
r 3h
O/
Coomasie
3 4 5 6 kDa 116 66 45 35 25
Silver
6 5 AS 87 kDa
Sample IPTG induced E. coli BL21 [pRSET A] Uninduced E. coli BL21 [pRSET A :: AS] IPTG induced E. coli BL21 [pRSET A :: AS] Soluble fraction IPTG induced E. coli BL21 [pRSET A :: AS] membrane fraction Ni-NTA purified AS Marker
o.
Parameters
Culture OD600 : 0.5 IPTG: 0.25, 0.5, 0.75 or 1.0 mM Incubation: 1, 2, 3 h or overnight
Temperature: 25 or 37 oC
kDa
116 66 45 35
AS 87 kDa
25
Fig. 1. SDS-PAGE of the over-expressed AS recombinant protein. A. Expression of recombinant His-tagged AS protein in E. coli BL21 DE3 pLys S. Ten micrograms of protein extracts prepared from IPTG-induced or uninduced E. coli BL21 DE3 pLys S cells containing pRSET A or pRSET A-AS were fractionated on 12.5 % SDS-PAGE and stained with coomassie brilliant blue R-250. Lanes contain protein extracts as follows; Lane 1. Total protein of uninduced E. coli BL21 DE3 pLys S (pRSET A), lane 2. total protein of IPTG-induced E. coli BL21 DE3 pLys S (pRSET A), lane 3. total protein of uninduced E. coli BL21 DE3 pLys S (pRSET A-AS), lane 4. total protein (soluble fraction) of IPTG-induced E. coli BL21 DE3 pLys S (pRSET A-AS), lane 5. total protein (insoluble fraction) of IPTG-induced E. coli BL21 DE3 pLys S (pRSET A-AS), lane 6, the purified recombinant AS fusion protein, lane 7. Protein marker. B. The Ni-NTA-purified lysate containing the recombinant AS fusion protein stained with silver nitrate.
-His
-bAS
0 0 40 :80 1: 1 0 60 :200 1 1 1:
To amplify BAS1 from pRSETA and clone into pET32b vector (with thioredoxin tag) BAS3F: Sal I site CCGTCGACGCATGTGGAAGCTTAAGATAGCGG BAS3R:Not I site TTGCGGCCGCTTAGGTGCCTAGGGACGG 1 2 3 4 5
6 kb 2.4 kb
2.6 kb
~4.5 kb 1.6 kb
35 PRO
AS
NOS TER
NOS PRO
npt II
NOS TER LB
P. ginseng seeds In vitro plantlets Nodal explants Callus induced [MS+2,4-D (1 mg/l) +Kn (0.1 mg/l)] Kanamycin sensitivity test MS + Kan [25 200 mg/l] 100 mg/l Co-cultivated with 0.5 O.D. culture of A. tumefaciens LBA 4404 [pBIN AR :: AS] for three days in dark Selection medium [MS semisolid + Cefotaxime (250 mg/l) + Kanamycin (100 mg/l)] thrice of 15 days incubation Transgenic calli [MS+2,4-D (1 mg/l) +Kn (0.1 mg/l)] In vitro shoot regeneration Somatic embryogenesis Transgenic plant
To be done
Molecular analysis of transformed P. ginsengplants to confirm the stable integration and the constitutive expression of -AS gene. In vitro -amyrin synthase assay and HPLC profiling. To get bAS in the soluble fraction in E. coli a.subcloning into pBAD vector for tightly controlled expression b.subcloning into pMAL vector (MBP fusions are generally cytosolic)
HPLC-chromatograms of a mixture of ginsenosides. Eluent: A, acetonitrile-water (27.5 : 72.5); B, acetonitrile-water (16.5 : 83.5) Column: Glass-ODS (4 rnm I.D. X 150 ram). Flow-rate: 1.0 ml/min. Detection at 203 nm.
Y. Matsushima et al
HPLC-chromatograms of a ginseng extract. Eluent: A, acetonitrile-water (27.5 : 72.5); B, acetonitrile-water (16 : 84) Column: Glass-ODS (4 mm I.D. X 150 mm). Flow-rate: 1.0 ml/min. Detection at 203 nm.
Y. Matsushima et al