Introduction to Plant Biotechnology

Course code: PlSc362

Credit hours: 2(1+1)/3 ECTS

ALMAZ TADESSE(MSc)
 Chapter four
Molecular Marker Technology
 Definition and Types of molecular markers

WHAT ARE MOLECULAR MARKERS

 information about an organism obtained from analysis of its molecules

– proteins, nucleic acid

 marker – information unit – part of the total information (targeted or randomly chosen)

 Show genetic similarity of individuals, populations or species

 EXAMPLES OF MARKERS
 information about enzyme molecule
 sequence of nucleotides in DNA
chain or specific (variable) position
(SNP)
 length of DNA fragment, absence or
presence of a fragment
 What are gene and genetic markers?

 If we consider a specific group of plants of a particular species and a set of characteristics of these plants
then this set of characteristics will be defined as a “trait” of that group provided, each plant possesses one
of these characteristics

 The state of trait will be known as “phenotype” and the genetic information possessed by each
plant will be known as “genotype”.

 Accordingly, a trait will be considered a “genetic trait” only, if any two individuals possess the same
genotype and also have the same phenotype irrespective of the environment in which they exist.

 The relationship between genotype and phenotype can be confirmed through inheritance analysis.

 If a trait is inherited successfully and assigned unambiguously to the phenotype or to a set of one or more
loci, than it will be known as “genetic marker”
CHARACTERISTICS OF MARKERS

 Provide unique information about individual genotype

 independent on environment conditions (unlike morphological
data)
 selectivelly neutral –no influence on individual fitness
 Markers are obtained from non-coding DNA regions

 unique information about organism – clone identification

 Are modified during generative reproduction – recombination
 OVERVIEW
1. Proteins – isozymes
 Morphological marker 2. DNA markers
 tall and short, 2.1 Hybridization based markers
2.1.1 RFLP (Restriction Fragment Length Polymorphism)
 resistant and
2.2 PCR based – analysis of DNA fragments
susceptible 2.2.1 Order of nucleotides – DNA sequences
2.2.2 “Whole genome“ analysis – fragment
 Biochemical marker length polymorphism
 Protein  RAPD (Random Amplified Polymorphic DNA)
 AFLP (Amplified Fragment Length Polymorphism)
 Isoenzyme 2.2.3 Information from specific genome regions
 microsatellites (Simple Sequence Repeats – SSRs)
 DNA markers
 Hybridization based 2.3 Whole genome markers – SNP, whole genome sequencing

 PCR based
ISOENZYMES (ISOZYMES)

 proteins catalyzing basic biochemical reactions

 isoenzymes (isozymes) – enzymes with the same metabolic
function, catalyzing the same reaction, but with different (primary)
structure
 extracted from living tissues – preferably leaves
 individual molecules (=alleles) electrophoretically separated
according to differences in their mobility (electric charge)
 APPLICATION OF ISOZYMES

 clone identification
 population genetics
 geographical variation
 hybrid identification, introgression
 phylogenetic relationships at the
level of closely related species
 evolutionary rate – molecular
clock
 ISOENZYMES
pros
 quick method – possible to analyse
many individuals simultaneously
 cheap technique (in comparison
with DNA techniques)
 data comparable among different
studies
 codominant marker
 slow mutation rate (advantage
against microsatellites)
cons
•living material needed
•restricted variability – low number of alleles
per locus – often 2-4 only
•variability in coding part of the genome
•detected variability
•10% of variability of DNA
•only 1/3 of nucleotide substitutions is reflected
by aminoacid changes
•and only 25% is detectable with
electrophoresis
 DNA based molecular marker
 DNA markers seem to be the best candidates for efficient evaluation and selection of plant material.

 Unlike protein markers, DNA markers segregate as single genes and they are not affected by the
environment.
 DNA is easily extracted from plant materials and its analysis can be cost and labour effective

What is an ideal DNA marker?

An ideal molecular marker must have some desirable properties.
1) Highly polymorphic nature: It must be polymorphic as it is polymorphism
that is measured for genetic diversity studies.
2) Codominant inheritance: determination of homozygous and heterozygous
states of diploid organisms.
3) Frequent occurrence in genome: A marker should be evenly and
frequently distributed throughout the genome.
4) Selective neutral behaviors: The DNA sequences of any organism are neutral to
environmental conditions or management practices.

5) Easy access (availability): It should be easy, fast and cheap to detect.

6) High reproducibility: To obtain reproducible results, the extraction of purified, high

quality DNA is a prerequisite for the majority of the marker techniques. Several factors
have been reported to influence the reproducibility of markers: quality and quantity of
template DNA, PCR buffer, primer to template ratio, annealing temperature, Taq DNA
polymerase brand or source, and thermal cycler brand.

7) Easy exchange of data between laboratories.

RFLP (Restricted Fragment Length Polymorphism)
 Different size DNA fragments are produced when
digested with restriction enzymes due to variation
in the enzyme’s target site
 The resulting fragments are separated
electrophoretically according to size,
 DNA is transferred by Southern blotting and
probed with DNA clones from the library.
 Fragments matching the probe DNA are
visualised by autoradiography techniques.
 RFLP detection relies on the possibility of
comparing band profiles generated
 Restriction fragment length polymorphism (RFLP)
analysis was one of the first techniques to be widely
used for detecting variation at the DNA sequence
level.
 The principle behind the technology rests on the
possibility of comparing band profiles generated
after restriction enzyme digestion in DNA molecules
of different individuals.
 Diverse mutations that might have occurred affect
DNA molecules in different ways, producing
fragments of variable lengths.
 These differences in fragment lengths can be seen
after gel electrophoresis, hybridisation and
visualisation
 RFLP
pros
 Highly robust and repeatable methodology
 Codominantly inherited and can estimate
heterozygosity
 No sequence information required
 Well suited for constructing genetic linkage
maps
 It has high discriminatory power-both at the
species and/or population levels
 Simplicity - given the availability of suitable
probes, the technique can readily be
applied to any species
Cons
• Large amounts of DNA is required
• Automation not possible
• Low levels of polymorphism in some species
• Few loci detected per assay
• Need a suitable probe library
• Time consuming, especially with single-copy
probes
• Costly
• Moderately demanding technically
Applications of RFLP

 Genetic diversity
 Genetic relationships
 History of domestication
 Origin and evolution of species
 Genetic drift and selection
 Comparative mapping
 Gene tagging
 Unlocking valuable genes from wild species
RAPD (Random Amplified Polymorphic DNA)

 The random amplified polymorphic DNA (RAPD) technique is a PCR-

based method that uses short primers (usually 10 bases) to amplify
anonymous stretches of DNA.
 With this technique, there is no specific target DNA, so each particular
primer will attach to the template DNA randomly whenever it gets its
complementary sequence.
 When the primers attach at two points, the region between these
attachment points will be amplified.
 It can detect several loci simultaneously usually resulting in
presence/absence polymorphism.
 Sources of polymorphism in RAPDs

 DNA polymorphism among individuals can be due to:

• Mismatches at the primer site
• The appearance of a new primer site
• The length of the amplified region between primer sites
 Because of the nature of RAPD markers, only the
presence or absence of a particular band can be
assessed.
 RAPD
pros
 High number of fragments
 Technically simple
 Arbitrary primers are easily
purchased, with no need for initial
genetic or genomic information
 Only tiny quantity of target DNA is
required
 Unit costs per assay/sample are
low
cons
• Dominant (not possible to know
heterozygosity)
• Lack of a priori knowledge on the
identity of the amplification products
• Problems with reproducibility
(repeatability)
Simple Sequence Repeats (SSRs)
 Simple Sequence Repeats (SSRs) or Microsatellites are short tandem repeats (2-5
bases), that repeat multiple times and flanked by a unique DNA sequence.
 Differences in fragment size (polymorphism) is due to differences in number of
repeats of the amplified product.
 Polymorphisms in the repeat region can be detected by performing a PCR using
specific primers that are complementary to the unique DNA flanking the repeated
sequence.
 To be used as markers, their location in the genome of interest must first be known.
•tandem repetition, shorter than 6 bp, usually 2, 3 or 4 bp

…GTTCTGTCATATATATATATAT----CGTACTT…
…GTTCTGTCATATATATATATATATATCGTACTT…
 alleles are defined by different number of repetitions
Simple Sequence Repeats (SSRs)

pros cons
 Require very little and not necessarily
high quality DNA
 Highly polymorphic
• Complex discovery procedure
 Evenly distributed throughout the • High initial development cost
genome (needs sequencing)
 Can be easily automated
 Good analytical resolution and high
reproducibility
 Very suitable marker for marker-
assisted breeding
 Applications of SSRs
 parentage analysis - parent identification of seeds (seedlings) in populations
 outcrossing rate

 clone identification

 population-genetic studies
 inbreeding, H-W equilibrium testing
 gene flow, migration
 population history, effective population size changes

 phylogeography
 systematics only at the level of closely related species
 necessary to use many loci (to cover the ‘’whole genome“ variation)
 cpDNA SSRs
Amplified Fragment Length Polymorphic (AFLP)

 AFLP is a type of DNA marker generated by the selective PCR amplification of restriction
enzyme digested DNA.
 It uses restriction enzymes to digest genomic DNA, followed by ligation of adaptors to the
sticky ends of the restriction fragments.
 A subset of the restriction fragments is then selected to be amplified. This selection is
achieved by using primers complementary to the adaptor sequence and a few nucleotides of
the restriction sequence
 AFLP
Pros
 AFLP allows a quick scan of the whole genome
for polymorphisms
 Because of the large number of bands
generated, each marker gives a highly
informative fingerprint
 They are highly reproducible
 No prior sequence information or probe
generation is needed
 Extremely useful in creating quick genetic maps
 Highly sensitive method for fingerprinting DNA of
any origin and complexity
Cons
 AFLP markers display dominance which is
difficult in differentiating heterozygotes from
homozygotes
 They are technically demanding in the
laboratory and especially data analysis
 AFLPs generate huge quantities of bands,
which scoring is difficult and need automated
analysis and therefore computer technology
Applications of AFLP

• Genetic diversity assessment

• Genetic distance analysis
• Genetic fingerprinting
• Analysis of germplasm collections
• Genome mapping
• Monitoring diagnostic markers
Single Nucleotide Polymorphism (SNPs)

 A SNP is defined as a single base change in a DNA sequence that occurs in a significant
proportion (more than 1 percent) of a large population.

 Unlike other markers, single nucleotide polymorphisms (SNPs) do not need gel-based assays.

 They are also the most abundant of all marker systems known so far, both in animal and plant
genomes.

 A large number of SNPs have already been developed in the human genome and other
organisms, proving useful for diagnosis works.
Single nucleotide polymorphisms (SNPs)
Applications of Molecular Markers in Plant Breeding

 Progress in plant breeding has traditionally relied on the careful evaluation of the
differences in physical characteristics or phenotypes between individual plants.
 The use of molecular markers to enhance plant breeding efforts is being widely
studied.
 A major area of research is the use of molecular markers to identify and manipulate
chromosome segments QTL (quantitative trait locus) controlling quantitative traits
The major Application of Molecular Markers in plant breeding
includes:-
 Genetic diversity study
 Selection of parents for crossing
 DNA fingerprinting for identification and protection of
varieties
 Marker assisted selection
 Gene mapping and QTL detection
 Chapter five
Genetic Engineering
(Recombinant DNA Technology)
 Introduction
 Genetic engineering/recombinant DNA technology/genetic modification/manipulation
are terms that apply to the direct manipulation of an organism's genes

 Recombinant DNA technology relies on the ability to manipulate DNA using nucleic acid
modifying enzymes

Genetic engineering has applications in many fields;

 medicine,
 agriculture,
 the environment, and
 food production.
 Examples are insect resistant maize, herbicide resistant crops and production of
crops with improved quality produce
 Genetic transformation: - A process by which the genetic material carried by an individual cell is
altered by the incorporation of foreign (exogenous) DNA into its genome.

 Genetic Transformation:- is the genetic alteration of a cell resulting from the direct uptake,
incorporation of foreign genetic material (exogenous DNA) from its surroundings and taken up
through the cell membrane(s).

 Transgenic – an organism containing foreign gene (transgene) introduced by in vitro gene transfer
techniques.
Recombinant DNA
• DNA that has been artificially manipulated to combine genes from two
different sources.
Recombinant DNA technology
• In genetic engineering, an artificial and deliberate recombination of pieces of DNA, from
different organisms, creating what is called recombinant DNA.
• The basic process of recombinant DNA technology involves manipulating
an organism’s DNA and thus altering the proteins being produced
 Cloning (Molecular Cloning) – the multiplication of DNA sequence in cloning vector that is
capable of replication.

 The main idea of molecular cloning is to insert a DNA segment of interest into an autonomously
replicating DNA molecule, also-called cloning vector, so that the DNA segment is replicated with
the vector.

 Vector: A plasmid, bacteriophage or virus into which foreign DNA can be introduced for the
purposes of cloning.
 In Genetic engineering plasmids and bacteriophages are most commonly used for this purpose. Other
types of vectors include cosmids, bacterial artificial chromosomes (BACs) and yeast artificial
chromosomes (YACs).

 Plasmid- is a DNA molecule that is separate from, and can replicate independently of, the chromosomal
DNA (out of nuclear DNA). They are double-stranded and, in many cases, circular. Plasmids usually
occur naturally in bacteria.

 Complementary DNA (cDNA):- is DNA synthesized from a messenger RNA (mRNA) template in a
reaction catalyzed by the enzyme reverse transcriptase and the enzyme DNA polymerase.

 Enhancer: - a short sequence of DNA that can increase transcription of genes by enhancing the activity
of promoter of the gene.

 Silencer:-a DNA sequence which suppresses the activity of promoter of the gene.
 Why genetic engineering?
 Now we have the ability to modify the genome very precisely, one gene at a time.
This new technique is called genetic engineering (GE), and has become a rather common
technique in those laboratories conducting such research. It has made possible precise
changes in varieties of plants, changes that have enabled man to increase both yields and
the quality of these crops

 Genetic engineering is not bound by the limitations of traditional plant breeding.

 Genetic engineering physically removes the DNA from one organism and transfers the
gene(s) for one or a few traits into another.
 Since crossing is not necessary, the 'sexual' barrier between species is
overcome. Therefore, traits from any living organism can be transferred into a
plant.
 This method is also more specific in that a single trait can be added to a plant.
 Whatever the case, both genetic engineering and conventional
breeding can be considered as advantage of crop plant genetic engineering
research
 WHY????Genetic engineering rather than Conventional breeding

It is
It is more faster
specific
 establishing the trait takes only one
 scientists can choose with great accuracy
generation compared with the many
the trait they want to establish.
generation needed for traditional
 Unwanted traits are not transferred unlike
selective breeding.
conventional breeding.

It is more It is less
flexible costly

 traits that would otherwise be unavailable in some

 much of the cost and labor
animal or plants may be achieved using transgenic
involved in administrating
methods, by transferring genes from other organism.
chemical treatments to plant
 Therefore it is not limited by species difference.
could be avoided.
For example .you can insert gene to plants from fish.
 Basic principles of the recombinant DNA technology

1. Identification and Isolation of DNA

2. Construction of DNA library
3. Construction of the gene of interest
4. Insertion of the isolated gene in to a suitable vector
5. Introduction of vector into host cell for multiplication/cloning
6. Selection of the transformed host cell, cells with the desired clone.
7. Introduction of cloned DNA in to the plant cell
8. Integration and expression of the trance gene and selection of transformed plant
cell
9. Regeneration of transgenic plants using tissue culture. In addition to these the
developed materials need to go through greenhouse and field testing before they
are released for commercial production.
 A. Isolate DNA

1. Isolating DNA/gene of interest

• Isolation of genomics DNA is accomplished by isolating cells, disrupting lipid

membranes with detergents, destroying proteins with phenol or proteases,

degrading RNAs with Rnase, leaving DNA at the end.

2. Isolation of plasmid vector DNA

• is accomplished by an alkaline lysis procedure which removes bacterial

chromosomal DNA from plasmid DNA.

B. Cutting the gene/DNA of
interest
1. Mechanical shearing
2. Restriction enzymes
C. Joining the gene/DNA
• Once we have isolated and cut the donor
and vector DNAs, they
must be joined together with DNA ligase
• Now we have the recombinant DNA
D. Amplifying the recombinant DNA (transformation)
• To recover large amounts of the recombinant DNA molecule, it
must be amplified. This is accomplished by transforming the
recombinant DNA into a bacterial host strain.
• Now we have DNA clone = A section of DNA that has been
inserted into a vector molecule and then replicated in a host cell
to form many copies.
E. Selection of host cells containing the recombinant
DNA.
• Selection involves growing transformed bacteria to make sure
they have the recombinant DNA. This is a necessary step
because transformation is not always successful. Only bacteria
that contain the recombinant DNA are selected for further use.
rDNA technology: tools
• Restriction Enzymes
•DNA ligases
• Vectors
Restriction Enzymes
• Naturally produced by bacteria – restriction endonucleases
• Natural function - destroy bacteriophage DNA in bacterial cells
• A restriction enzyme
• Substrate –DNA -recognizes one particular nucleotide sequence in DNA and cuts the
DNA molecule (breaks down the bond between two nucleotides)

• Prepackaged kits are available for rDNA techniques

Table. selected restriction enzymes used in rDNA technology
 DNA ligase

• enzyme that can link together DNA strands that have double-strand
breaks (a break in both complementary strands of DNA).
• Naturally DNA ligase has applications in both DNA replication and DNA repair .
• Needs ATP
• DNA ligase has extensive use in molecular biology laboratories for
genetic recombination experiments
Vectors

• small pieces of DNA used for cloning (the gene to be inserted into the genetically
modified organism must be combined with other genetic elements in order for it to
work properly)
• Used as a vehicle to artificially carry foreign genetic material into another cell,
where it can be replicated.

Requirements of the Vector

1. Self-replication - able to replicate in the host (origin of replication)
2. Cloning site (site for recognition of restriction enzymes)
3. Promoter to support the gene (new DNA) expression in the host
4. Selectable marker – antibiotic resistance
5. Proper
Plant Cloning Vectors

a)Used for purposes such as resistance to disease, pests, and

herbicides; improving crop quality and yield; improving
nutritional quality; and increasing the shelf life of foods.

b)Most commonly used plant vectors are the tobacco mosaic

virus and the Ti plasmid from the soil bacterium Agrobacterium
tumefaciens.
Hosts for DNA recombinant technology
1. Bacteria
- E. coli - used because easily grown and its
genomics are well understood.
• Gene product is purified from host cells
2. Yeasts - Saccharomyces cerevisiae
• Used because it is easily grown and its genomics are known
• May express eukaryotic genes easily
• Continuously secrete the gene product.
• Easily collected and purified
3. Plant cells and whole plants
• May express eukaryotic genes easily
• Plants are easily grown - produce plants with new properties.
4. Mammalian cells
• May express eukaryotic genes easily
• Harder to grow
• Medical use.
Methods to insert DNA into a host cell
1.Transformation (Co-cultivation)
2. Electroporation
*use electrical current to form microscopic pores in the membranes of
cell
3. Protoplast fusion
4. Microinjection
Plant transformation techniques
The most widely used transformation techniques are:
• Agrobacterium tumefaciens-mediated
• Micro-projectile bombardment (“gene gun” or biolistic method)
• Electroporation (Direct gene transfer to protoplasts)
• Agrobacterium-mediated method is considered preferable to
the gene gun due to the higher frequency of single-site
insertions of the foreign DNA into the host genome, making
the transformation process easier to monitor
Agrobacterium tumefaciens-mediated
transformation
• A. tumefaciens (soil bacteria, a natural engineer) have the ability to transfer a
defined sequence of their DNA known as the Ti (tumour-inducing) plasmid to
the plant cell in the infection process.
• The Ti plasmid contains a series of vir (virulence) genes that direct the infection
process, and a stretch of DNA termed T-DNA (transfer DNA), approximately 20 kb in
length, that is transferred to the plant cell in the infection process

• Upon integration, the bacterial DNA directs the synthesis of several proteins
that ensure the proliferation of the bacterial population within the infected plant

• The T-DNA encodes proteins required for the maintenance of infection

• Agrobacterium can only infect plants through plant root or stem wounds resulting in
certain chemical signals
• In response to these signals, bacterial vir genes become activated and direct a
series of events necessary for the transfer of the T-DNA from the Ti plasmid to the
plant cell through the wound
• To use A. tumefaciens and the Ti-plasmid as a transgene vector, the tumor
inducing section of T-DNA is removed, while the T-DNA border regions and the
vir genes are retained.
• The desired transgene is inserted between the T-DNA border regions,
applying
recombinant DNA technology.
• Thus, in the infection process, the transgene DNA is transferred to the plant
cell and integrated into the plant’s chromosomes

• To achieve transformation, Agrobacterium cells carrying an

appropriately constituted Ti plasmid vector containing the desired
transgene can be inoculated into plant stems, leaf disks etc., to allow
infection and T-DNA transfer to the plant cells.

• The explants that have been co-cultivated with Agrobacterium are subsequently processed
through various tissue culture steps resulting in the selection, regeneration and production of
transformed cells and plants.
Genetically modified organisms (GMO’s)
 Global area coverage by GMOs
 What are GMO’s?
 Benefits of GMO’s
 Controversies surrounding GMO’s and products
Area of genetically modified (GM) crops worldwide as of 2017
source (https://www.isaaa.org)
Area of genetically modified (GM) crops worldwide in 2016,
by country (in million hectares)
What are GMO’s?
• are organisms whose genetic material have been altered using
one of the techniques of recombinant DNA technology.
• The following techniques are not considered to result in genetic
modification, on condition that they do not involve the use of
recombinant-DNA molecules or genetically modified organisms
1. in-vitro fertilization
2. natural processes such as: conjugation and viral infection
3. polyploidy induction ?
Benefits of GMO’s
In crops:
• Increased resistance (Bt-cotton)
• Improved shelf life (Tomato)
• Enhanced taste
• Enhanced nutrition (golden rice)
• New products and techniques

In society:
• Increased food security for growing population
Benefits of GMO’s

In animals:
• Increased resistance and productivity
• Improved animal health and diagnostic methods
• Better yields of egg, milk and meat
In the environment:
• Better waste management
• Conservation of soil, water and energy
• “Friendly” bio-herbicides and bio-insecticides
 Controversies of GMO’s
Ethics:
• Violation of natural intrinsic values
• Objections to consuming animal or microbial gene products
• Stress to animals
• Tampering with nature by mixing genes “playing God”

Safety:
• Potential health impacts (allergens, antibiotic resistance marker genes, un-intended
effects,
• Potential environmental impacts: (unintended transfer of transgenes through gene
flow, unknown effects on other organisms such as soil microbes, loss of flora and fauna)
Controversies of GMO’s
Society:
• New technologies may be skewed towards the interests of rich countries.
(Ethiopia’s biosafety case,WikiLeaks)

Labeling:
• Mixing of GMO’s with non GMO’s confound labeling attempts
• In some countries is mandatory
Access and IPR’s
(intellectual property
right)
-Domination of food
production by few
companies (Monsanto vs
Bayern)
-Increasing dependence
on industrialized nations
-Bio-piracy, increased
exploitation of natural
resources
In summary
•GMOs multifaceted benefits
• biotech crops are considered as the fastest adopted crop
technology in the history of modern agriculture.
• controversies covering many areas
• Safety, ethics, society and IPRs and markets
 Biological risk and risk assessment
Safety and risk
• “Safe” and “Safety” are ideal concepts which, while desirable, are unattainable in absolute terms.
• We need to plan for safety
• But, practical planning for safety is difficult as safety cannot be measured directly.
• Practical planning for safety is performed by evaluating its opposite; risk.

What are risk and safety?

• Risk – the likelihood that under particular conditions of exposure an intrinsic hazard
will represent a threat or harm
• Risk is a function of hazard and exposure, Risk = hazard x exposure
 Risk assessment of a GMO

• To assess if the introduction of a GMO into the environment would

have adverse effects on human and animal health or the environment.

• involves generating, collecting and assessing information on the GMO

to determine its potential adverse impact relative to its non- GM
counterpart or comparator
Categories of hazards from the release of transgenic
crop plants include:
1. hazards associated with the movement of the transgene itself with subsequent
expression in a different organism or species (Gene Flow)????????
2. hazards associated directly or indirectly with the transgenic plant as a whole,
3. non-target hazards associated with the transgene product outside the plant,
and
4. resistance evolution in the targeted pest populations.
5. A fifth category of hazard is that of indirect effects on human health that are
mediated by the environment
6. effects on genetic diversity (The EU recognizes this ) as a separate category of
environmental hazard in its modified directive 90/220 (European Commission
2001).
Risk assessment of GMO’s: basic principles
• Risk assessment should be carried out in a scientifically sound and transparent
manner.
• It should include any relevant data (e.g. research data, scientific publications,
monitoring reports) obtained prior to and/or during the risk assessment process
• The final risk evaluation should result in qualitative and if possible quantitative
conclusions on the risks
• Any uncertainties associated with the identified risks should also be outlined.
Should be on a case-by-case basis as required information may vary:
• according to the species of GM plants concerned,
• The introduced genes,
• Their intended use/s
• The potential receiving environment/s,
• Specific cultivation requirements
• the presence of other GM plants in the vicinity
Intended vs unintended effects of GMO’s/ of genetic
modification
Intended effects
• are those that are designed to occur and which fulfill the original objectives of the
genetic modification. Alterations to the phenotype may be identified through a
comparative analysis of growth performance, yield, pest and disease resistance, etc.

Unintended effects
• are those which are consistent (non-transient) differences between the GM plant
and its appropriate comparator, which go beyond the primary intended effect/s of
introducing the transgene
Things to consider during risk assessment of GM plants
• Plant to Plant (gene flow)
• Plant to microorganism
• GM to target organism
• GM to Non target organism
• the environmental impact of the specific management and production
systems (e.g. agriculture, forest tree or others) associated with the GM
plant
How to minimize risk of GMOs: General considerations
1. GMOs should be designed to reduce environmental risks
2. More extensive studies of the environmental benefits and risks associated with GMOs are needed
3. These effects should be evaluated relative to appropriate baseline scenarios (e.g. conventional vs.
engineered crops)
4. The environmental release of GMOs should be prevented if scientific knowledge about possible
risks is clearly inadequate
5. In some cases, post-release monitoring will be needed to identify, manage, and mitigate
environmental risks
6. Science-based regulation should subject all transgenic organisms to a similar risk assessment
framework and should incorporate a cautious approach, recognizing that many environmental
effects are GMO- and site-specific and
7. Ecologists, agricultural scientists, molecular biologists, and others need broader training and wider
collaboration to address these recommendations.
Summary
• The Genetically Modified Organisms (GMOs) in the plant world are those plants
which are produced in the laboratory by incorporating into the native DNA of the
plant, a small DNA portion carrying a gene that is foreign to the native species.

• This foreign gene is a recombinant DNA construct (rDNA) with all other
regulatory switches to help the foreign gene express in its new genetic environment.

• This expression can be different from its original expression to the extent of
expression which may make the GMO overproduce, under produce, differently
produce or not produce the protein product it is known to produce.
• The release of GMO’s can be potentially harmful (RISK) to the
environment, human health, and to the society
• Example: GMOs could become invasive, harm other non-target
and endangered species, result in loss of biodiversity, etc.
Hence,
• Scientists came up with the idea of regulating the part of biotechnology
that deals with GMO’s.
• It is widely recognized that there is a need for each country to establish a regulatory
regime specifically to assess the safety of products of modern biotechnology.
• The regulation is based on biosafety laws and guidelines
Biosafety law and guideline or framework typically
includes four important elements:
1. a national biosafety policy instrument (e.g law, act or decree),
2. a regulatory system,
3. a system for monitoring
4. compliance and procedures for ensuring transparency, public
participation and accountability.
 What is biosafety
• A set of procedures, policies and measures that can help to
significantly reduce potential risks biotechnology could pose to the
environment, humans and animal health.

• The aim of biosafety procedures is to maximize the benefits obtained

from the application of biotechnology while minimizing potential
risks.
How are GMO’s regulated in Ethiopia? Actors and laws
• Ethiopia ratified the Convention on Biological Diversity (CBD) in 1994 (by
Proclamation No. 98/1994)
• signed the Cartagena Protocol on Biosafety to the CBD on 24 May 2000 and finally
ratified it on 22 September, 2003 (by Proclamation No. 362/ 2003).
• Every party to the protocol is expected to develop a National Biosafety Framework
(NBF) in order for the effective regulations of GMO’s to protect the public and the
environment.
Ethiopia’s National Biosafety Framework (draft)

• Based on this, Ethiopia developed a draft biosafety protocol

• It is a government policy on biosafety

• Is a regulatory system that aims to handle notifications/ applications, enforcement
and monitoring mechanism and public awareness
Objective of the Proclamation
• is to protect human and animal health, biological diversity and in general, the
environment , local communities and the country at large by preventing or at
least managing down to levels of insignificance the adverse effects of
modified organisms.
THANK YOU