The central dogma describes the process by which DNA is transcribed into mRNA and then translated into protein. DNA is first replicated semi-conservatively to make copies. Transcription involves RNA polymerase making an mRNA copy of a gene's DNA sequence. Translation then uses the mRNA to direct protein synthesis on ribosomes, where transfer RNAs match their anticodons to the mRNA codons and add the corresponding amino acids to form a polypeptide chain.
The central dogma describes the process by which DNA is transcribed into mRNA and then translated into protein. DNA is first replicated semi-conservatively to make copies. Transcription involves RNA polymerase making an mRNA copy of a gene's DNA sequence. Translation then uses the mRNA to direct protein synthesis on ribosomes, where transfer RNAs match their anticodons to the mRNA codons and add the corresponding amino acids to form a polypeptide chain.
The central dogma describes the process by which DNA is transcribed into mRNA and then translated into protein. DNA is first replicated semi-conservatively to make copies. Transcription involves RNA polymerase making an mRNA copy of a gene's DNA sequence. Translation then uses the mRNA to direct protein synthesis on ribosomes, where transfer RNAs match their anticodons to the mRNA codons and add the corresponding amino acids to form a polypeptide chain.
template? How is RNA made out of DNA template? How is Protein made out of RNA template? How does mutation result to change in the structure and function if a protein? Central Dogma: -is the process by which the instructions or information (nitrogenous bases) in the DNA are converted into a functional product- protein Characteristics of DNA: *made up of 2 strands -twisted -in double helix shape Characteristics of DNA: *Each strand is made up of a sequence of 4 chemical bases represented by the letters A, C, G, and T There are three molecules that form the basic building block of DNA, the NUCLEOTIDES PHOSPHATE GROUP ONE SUGAR MOLECULE NITROGENOUS BASES ( ADENINE- Thymine, Guanine-Cytosine) Characteristics of DNA:
*The 2 strands are
complementary* Characteristics of DNA: Each strand has a 5’ end and a 3’ end* Characteristics of DNA: The 2 strands run in opposite directions. Central Dogma: Replication: DNA replication - 3D (1).mp4 Replication: *Unwinding and unzipping of the DNA done by helicase Replication: *Result in the formation of a replication fork* Replication: Replication: *Primase makes a small piece of RNA called primer Replication: Replication: *DNA polymerase binds to the primer and will make the new strand of DNA by adding bases in 1 direction (from the 5’ end to the 3’ end)* Replication: Example: (leading strand) 3’ GGCGTACACACTCTATGTAA 10 20 C C G G T T C T G T G A C A A T C GA G 30 5’ Replication: Answer: CCGCATGTGTGAGATACATT 10 G G CC A A G A CA C T G T T A G C T C 30 Replication: *DNA polymerase makes the new strand of lagging strand by adding bases in 1 direction (from the 5’ end to the 3’ end) but this time in a series of small chunk Replication: *Exonuclease removes all the RNA primers from both strands of DNA Replication: *DNA polymerase then fills in the gaps that are left behind with DNA by adding bases Replication: *DNA ligase seals up the fragments of DNA in both strands to form a continuous double strand Replication: DNA replication is described as semi- conservative * Transcription: -is the process of transcribing (creating or replicating) a complementary, newly assembled piece of mRNA strand out of the genetic information stored in a sequence of DNA -transcribing a mRNA from DNA Transcription: DNA transcription and transla tion [HD animation].mp4 Transcription: *The gene, which codes for an RNA, begins with a promoter region and ends in a terminator region Transcription: 3 stages: initiation elongation termination Transcription: Initiation: *RNA polymerase binds to the promoter region Transcription: Initiation: *the DNA double helix unwinds and unzips Transcription: Elongation: *the RNA polymerase slides along the template DNA strand to add bases to create the mRNA Transcription: Exmple: CAC AAA ACA ATG ATA TTA GTA TTC TCC Transcription: Answer: CAC -GUG AAA -UUU ACA -UGU ATG -UAC ATA -UAU TTA -AAU GTA -CAU TTC -AAG TCC -AGG Transcription: Termination: *the RNA polymerase, the DNA strand, and mRNA transcript dissociate from each other Transcription: Termination: mRNA is modified by adding 5’ cap and a 3’ poly- A tail Transcription: mRNA that is made during transcription includes regions called exons that code for a protein, and non-coding sections called introns* Transcription: Termination: *spliceosome removes the introns through the process called intron splicing Transcription: Termination: *spliceosomes bind to the ends of the introns and join the adjacent exons to produce a mature mRNA Transcription: Termination: *the mature mRNA strand leaves the nucleus trough a nuclear pore and enters the cytoplasm Translation: Once the mRNA is already in the cytoplasm, translation will begin Translation: *is the process by which mRNA is decoded and translated to produce a polypeptide sequence, otherwise known as a protein Translation: *the nitrogenous bases are grouped into 3 letter codes –codons* Translation: Example: GUGUUUUGUUACU 10 A U A A U C A U A AG A G G 20 Translation: Answer: GUG UUU UGU UAC UAU AAU CAU AAG AGG Trivia!!! -there are 64 codons which code for amino acids Trivia!!! -4 out of 64 are special codons: AUG-”start” codon UAA, UAG, UGA –”stop” codons Translation: 3 stages: initiation elongation termination Translation: Initiation: *small ribosomal subunit binds to the start codon of the mRNA strand Translation: Initiation: *amino acid is brought to the ribosome by a specific transfer RNA molecule* Translation: Example: AUG CAC AAA ACA AUA UUA GUA UUC UCC UAA Translation: Example: Anticodon: AUG CAC AAA ACA AUA UUA GUA UUC UCC UAA Amino Acid: Met His Lys Thr Ile Leu Val Phe Ser Stop Amino Acids: Ala: Alanine Arg: Arginine Asn: Asparagine Asp: Aspartic acid Cys: Cysteine Glu: Glutamic acid Gln: Glutamine Gly: Glycine His: Histidine Ile: Isoleucine Leu: Leucine Lys: Lysine Met: Methionine Phe: Phenylalanine Pro: Proline Ser: Serine Thr: Threonine Trp: Tryptophan Tyr: Tyrosine Val: Valine Translation: Initiation: *tRNA molecule binds to start codon Translation: Initiation: *the large ribosomal subunit binds to the start codon to form the translation complex Translation: the large ribosomal subunit has 3 distinct regions, called the E, P, and A sites Translation: Translation: Elongation: *tRNA molecule binds to the A site and a peptide bond forms between its amino acid and the one attached to the tRNA molecule at the P site Translation: Elongation: *the translation complex slides down one codon to the right* Translation: Elongation: *uncharged tRNA molecule exits from the E site and the A site is open to accept the next tRNA molecule Translation: 2nd step: the translation complex slides down one codon to the right 3rd step: uncharged tRNA molecule exits from the E site and the A site is open to accept the next tRNA molecule (Note: These 2nd and 3rd steps continue until a stop codon is reached.) Translation: Termination: *A release factor binds to the A site at a stop codon and the polypeptide is released from the tRNA in the P site Translation: Termination: *the entire complex dissociates and can reassemble to begin the process again at initiation