UNIT-1

BASIC TOOLS IN GENETIC

ENGINEERING
Restriction enzymes & Ligases -
Classification nomenclature
Modified Bases in DNA
 Enzymes employed in manipulating DNA

I. Nucleases (DNase-Endo & Exonucleases) RNase,

II. Ligases
III. Kinase and alkaline phosphatase
IV. DNA polymerases
V. Topoisomerase
VI. Helicase
Nucleases break the phosphodiester bond
 What are restriction enzymes?

• Molecular scissors that cut double stranded DNA

molecules at specific points.

• Found naturally in a wide variety of prokaryotes

• An important tool for manipulating DNA.

 Discovery

• Arbor and Dussoix in 1962 discovered that certain

bacteria contain Endonucleases which have the
ability to cleave DNA.
• In 1970 Smith and colleagues purified and
characterized the cleavage site of a Restriction
Enzyme.
• Werner Arbor, Hamilton Smith and Daniel Nathans
shared the 1978 Nobel prize for Medicine and
Physiology for their discovery of Restriction Enzymes.
 Biological Role

• Most bacteria use Restriction Enzymes as a defense

against bacteriophages.

• Restriction enzymes prevent the replication of the

phage by cleaving its DNA at specific sites.

• The host DNA is protected by Methylases which add

methyl groups to adenine or cytosine bases within
the recognition site thereby modifying the site and
protecting the DNA.
 Classification
• Synonymous to Restriction Endonuclease
• Endonuclease: Cut DNA from inside
• Highly heterogeneous
• Evolved independently rather than diverging
form a common ancestor
• Broadly classified into four Types
 R-M System
 Restriction-modification (R-M) system
– Endonuclease activity: cuts foreign DNA at the
recognition site
– Methyltransferase activity: protects host DNA
from cleavage by the restriction enzyme.
– Methyleate one of the bases in each strand
• Restriction enzyme and its cognate
modification system constitute the R-M
system
 Protection of Self DNA

• Bacteria protect their self DNA from restriction

digestion by methylation of its recognition site.

• Methylation is adding a methyl group (CH3) to DNA.

• Restriction enzymes are classified based on

recognition sequence and methylation pattern.
 Type I
• Multi-subunit proteins
• Function as a single protein complex
• Contain
– two R (restriction) subunits,
– two M (methylation) subunits and
– one S (specificity) subunit
• Cleave DNA at random length (even about 1000bp)
from recognition site
 Type III
• Large enzymes
• Combination restriction-and-modification
• Cleave outside of their recognition sequences
• Require two recognition sequences in opposite
orientations within the same DNA molecule
• No commercial use or availability
Modified Bases in DNA
 Type IV
• Cleave only modified DNA (methylated, hydroxymethylated
and glucosyl-hydroxymethylated bases).
• Recognition sequences have not been well defined
• Cleavage takes place ~30 bp away from one of the sites.
• Sequence similarity suggests many such systems in other
bacteria and archaea.
 Type II
 Most useful for gene analysis and cloning
 More than 3500 REs
 Recognize 4-8 bp sequences
 Need Mg 2+ as cofactor
 Cut in close proximity of the recognition site
 Homodimers
 ATP hydrolysis is not required
 Types of Restriction Enzymes
Recognition Cleavage Location of Co factors
Site methylase Examples
site

Type I dsDNA Random Endonuclease Mg2+, ATP, EcoK I

Around and methylase S-Adenosyl EcoA I
1000bp away located on a methionine CfrA I
from single protein
recognition molecule
site
Type II Generally Specific Endonuclease Only Mg2+ EcoR I
dsDNA with Within the and methylase No other BamH I
dyad recognition are separate Cofactor Hind III
symmetry or site entities required
mirror image

Type III ssDNA Random Endonuclease Mg2+, ATP. EcoP I

24-26 bp and methylase S-Adenosyl Hinf III
away from located on a methionine EcoP15 I
recognition single protein enhances
Recognition sites of most restriction enzymes
have a two fold rotational symmetry

Restriction enzymes have corresponding symmetry to facilitate

recognition
 Nomenclature
• Smith and Nathans (1973) proposed enzyme naming
scheme
– three-letter acronym for each enzyme derived from the
source organism
– First letter from genus
– Next two letters represent species
– Additional letter or number represent the strain or
serotypes
• For example. the enzyme HindII was isolated from
Haemophilus influenzae serotype d.
The recognition sites of type II RE are read from the 5’ to the 3’
.

For example BamH1 recognizes the six base-pair sequence G GATCC.

Which is 5’to 3’ ie . 5’ GGATCC 3’

5’GAGGATACCACCAGGGTTACAGGATAGGAGTCAGGATCCAGAGGACCTAGGATACCTC3’ 3’C
TCCTATGGTGGTCCCAATGTCCTATCCTCAGTCCTAGGTCTCCTGGATCCTATGGAG5’

is digested by Bam HI (at the site shown in red) to give two fragments of DNA...
5’GAGGATACCACCAGGGTTACAGGATAGGAGTCAG GATCCAGAGGACCTAGGATACCTC3’
3’ CTCCTATGGTGGTCCCAATGTCCTATCCTCAGTCCTAG GTCTCCTGGATCCTATGGAG 5’
Sometimes Type II RE are referred to as 4 cutter, 5 cutter or six cutter based on how
many nucleotides they recognize.

For example BamH1 is a 6 cutter since it recognizes the six base-pair sequence GGATCC

In reality there are more than six nucleotides on each strand, of course. The Bam HI just
looks for the specific sequence it's interested in, and will accept no substitutes:

5’GAGGATACCACCAGGGTTACAGGATAGGAGTCAGGATCCAGAGGACCTAGGATACCTC3’
3’CTCCTATGGTGGTCCCAATGTCCTATCCTCAGTCCTAGGTCTCCTGGATCCTATGGAG5’

is digested by Bam HI (at the site shown in red) to give two fragments of DNA...
5’GAGGATACCACCAGGGTTACAGGATAGGAGTCAG GATCCAGAGGACCTAGGATACCTC3’
3’CTCCTATGGTGGTCCCAATGTCCTATCCTCAGTCCTAG GTCTCCTGGATCCTATGGAG 5’
Restriction fragments can be blunt ended or
sticky ended

5’ G A A T T C 3’ 5’ C C C G G G 3’
3’ C T T A A G 5’ 3’ G G G C C C 5’

Sticky Ends Blunt Ends

Sticky ends are more easy to ligate compared to blunt ends.

In the example of digestion with the enzyme BamHI, it's obvious that the newly created ends of
the DNA do not line up evenly with each other. On each fragment, there is a four-nucleotide
sequence 5'-GATC that hangs off the end and doesn't base-pair (because the other fragment
has broken away and moved off).

Since the one end that hangs over past the other has a free 5' end, we say that BamHI
digestion creates a "5' overhanging end" which we sometimes call a "5' overhang.“

Another term that means the same thing is to say that overhanging ends are "cohesive ends"
or "sticky ends" meaning that they could hydrogen bond to other compatible complementary
strands (compatible in the sense of Watson-Crick base pairing). By our usual convention of
writing DNA, a 5' overhanging end has a characteristic shape.
 Isoschizomers and Neochischizomers

• Restriction enzymes that have the same recognition sequence as well as

the same cleavage site are Isoschizomers. EcoRI and FunII

• Restriction enzymes that have the same recognition sequence but cleave
the DNA at a different site within that sequence are Neoschizomers.
• Eg: Sma I and Xma I

CCCGGG CCC GGG

GGGCCC GGG CCC
Xma I Sma I

For example, SphI (CGTAC/G) and BbuI (CGTAC/G)

 Mechanism of Action

Restriction Endonuclease scan the length of the DNA ,

binds to the DNA molecule when it recognizes a
specific sequence and makes one cut in each of the
sugar phosphate backbones of the double helix – by
hydrolyzing the phoshphodiester bond.
Specifically, the bond between the 3’ Oxygen atom
and the Phosphorus atom is broken.
Direct hydrolysis by nucleophilic attack at the
phosphorous atom

3’OH and 5’ PO43- is produced. Mg2+ is required for the catalytic activity of
the enzyme. It holds the water molecule in a position where it can attack
the phosphoryl group and also helps polarize the water molecule towards
deprotonation .
• The resultant two fragments have newly-exposed 5' and 3' ends.
• And nearly all restriction enzymes leave a phosphate on the
exposed 5' end.
• The enzyme Nci I, an exception to the rule, leaves a 3' phosphate.
 What does a restriction enzyme need in
order to do its duty?
1. A double-stranded DNA sequence containing the recognition
sequence.
2. Suitable conditions for digestion.

For example, BamHI has the recognition sequence: GGATCC

and requires conditions similar to this:
10 mM Tris-Cl (pH 8.0)
5 mM Magnesium chloride
100 mM NaCl
1 mM 2-mercaptoethanol

Reaction conditions: 37 C
• On the other hand, the enzyme Sma I has the recognition
sequence: CCCGGG and requires conditions such as:
• 33 mM Tris-acetate (pH 7.9)
10 mM Magnesium acetate
66 mM Potassium acetate
0.5 mM Dithiothreitol
•
Reaction conditions: 25 C.

• Most restriction enzymes are used at 37 C, however Sma I

is an exception.

• Other examples of temperature exceptions are Apa I (30

C), Bcl I (50 C), BstEII (60 C), and Taq I (65 C).
 Unit
• 1 unit of restriction enzyme will completely
digest 1 μg of substrate DNA in a 50 μl
reaction in 60 minutes
 Star Activity
• Under non-standard reaction conditions, some
restriction enzymes are capable of cleaving
sequences which are similar, but not identical, to
their defined recognition sequence. This altered
specificity has been termed “star activity".

• It has been suggested that star activity is a general

property of restriction endonucleases and that any
restriction endonuclease will cleave noncanonical
sites under certain extreme conditions.
Conditions that Contribute to Star Activity Steps that can be Taken to Inhibit Star Activity

High glycerol concentration (> 5% v/v)
Restriction enzymes are stored in 50% glycerol,
therefore the amount of enzyme added should not
exceed 10% of the total reaction volume. Use the
standard 50 µl reaction volume to reduce evaporation
during incubation.

High concentration of enzyme/µg of DNA ratio (varies Use the fewest units possible to achieve digestion. This
with each enzyme, usually 100 units/µg) avoids overdigestion and reduces the final glycerol
concentration in the reaction.

Non-optimal buffer Whenever possible, set up reactions in the

recommended buffer. Buffers with differing ionic
strength and pH may contribute to star activity.

Prolonged reaction time Use the minimum reaction time required for complete
digestion. Prolonged incubation may result in
increased star activity, as well as evaporation.

Presence of organic solvents [DMSO, ethanol, ethylene Make sure the reaction is free of any organic solvents,
glycol, dimethylacetamide, dimethylformamide, such as alcohols, which might be present in the DNA
sulphalane. preparation.

Substitution of Mg2+ with other divalent cations (Mn2+, Use Mg2+ as the divalent cation. Other divalent cations
Cu2+, Co2+, Zn2+) may not fit correctly into the active site of the
restriction enzyme, possibly interfering with proper
Structure of EcoR V endonuclease

• Consists of two subunits –

dimers related by two fold
rotational symmetry.
• Binds to the matching
symmetry of the DNA
molecule at the restriction
site and produces a kink at
the site.
Hydrogen bonding interactions between EcoRv and its DNA
substrate
A comparison of cognate and non-specific DNA in the EcorV-
DNA complex.
 Restriction Enzymes-
Applications

Restriction Enzymes can

be used to generate a
restriction map. This can
provide useful
information in
characterizing a DNA
molecule.
 Applications….
Restriction Fragment Length Polymorphism is a tool to study variations
among individuals & among species
 Uses….

Restriction enzymes are

most widely used in
recombinant DNA
technology.
Buffers are crucial for activity of enzymes!
Ideal biochemical buffers:

•pKa between 6 and 8

•Chemically inert
•Polar (soluble and not membrane permeable)
•Non-toxic
•Inexpensive
•Salt and temperature indifferent

The pKa of Tris buffer is 8.0

Tris(hydroxymethyl)aminomethane (THAM): the free base form

(pH 7.5-8.5)
Tris-HCl: the acidic form (for pH 7-8)
Tris is widely used, but it isn’t perfect:

•Buffering is weak below pH 7.5 and above pH 9.0

•pH must be measured using a special pH meter electrode
•Toxic to many types of mammalian cell cultures
•Tris solution pH changes with temperature! Drops 0.03 pH units for each degree C
increase
•Tris solution pH changes with concentration! Example: 10mM Tris pH 7.9, 100mM Tris
pH 8.0

•Below pH 7.5, use a “Good” buffer: HEPES, Tricine, BES, MOPS, MES
 Enzyme “reaction buffers”
•Buffer: Tris, HEPES, etc.

•Salt: NaCl, KCl, PO4-, etc.--stabilizes protein structure, facilitates protein-DNA

interactions

•Divalent metal ions: Mg2+, Ca2+, Zn2+, etc.--often required for enzyme activity

•Glycerol: for Cryo-preservation-Prevents ice crystal formation-stabilizes protein

structure

•EDTA: chelates (removes) divalent cations--important especially for storage, if

enzyme is especially sensitive to metal ion-dependent proteases

•Beta mercaptoethanol or dithiothreitol: reducing agents that prevent

“illegitimate” disulfide bond formation

•Non-specific protein: Bovine serum albumin (BSA) for protein stability

•Other cofactors, eg. ATP, NADH for activity

 References

• Biochemistry (1995), Wiley & Sons, Inc.

Voet D. and Voet J.G.
• Biochemistry (2002), Freeman & Co.
Berg, J.M., Tymoczco, J.L., Stryer, L.
• An Introduction to Genetic Analysis (2000), Freeman & Co.
Griffiths, A., Miller, J.H., Suzuki, D.T., Lewontin, R.C., Gelbart, W.M.
• Molecular Cell Biology (2000), Freeman & Co.
Lodish, Berk, Zipursky, Matsudaria, Baltimore, Darnell
 DNA LIGASE
• DNA ligases seals nicks in the phosphodiester backbone of DNA.

• Biologically, DNA ligases are essential for the joining of Okazaki fragments
during replication, and for completing short-patch DNA synthesis
occurring in DNA repair process. There are two classes of DNA ligases.

• The first uses NAD+ as a cofactor and only found in bacteria.

• The second uses ATP as a cofactor and found in eukaryotes, viruses and
bacteriophages.

• The smallest known ATP-dependent DNA ligase is the one from the
bacteriophage T7 ( 41KDa).

• Most Commonly used DNA ligase is T4 DNA ligase which uses ATP

• Eukaryotic DNA ligases may be much larger (human DNA ligase I is

100KDa) but they all appear to share some common sequences and
 DNA Ligase Mechanism
The reaction occurs in three stages in all DNA ligases:
1. Formation of a covalent enzyme-AMP intermediate linked to a lysine side-chain in the
enzyme.
2. Transfer of the AMP nucleotide to the 5’ phosphate of the nicked DNA strand.
3. Attack on the AMP-DNA bond by the 3’-OH of the nicked DNA sealing the phosphate
backbone and resealing AMP.
Ligase-Mechanism of action

3’OH & 5’ Phosphate required for ligation

 UNIT
• Weiss unit - the amount of ligase that catalyzes
the exchange of 1 nmole of 32P from
inorganic pyrophosphate to ATP in 20 minutes
at 37°C.

• Many commercial suppliers of ligases use an

arbitrary unit based on the ability of ligase to
ligate cohesive ends. These units are often more
subjective than quantitative and lack precision.
• Hybridization

• Hyperchromicity

• DNA absorption maxima 260nm

• 10kb (10,000)
Label
Radioactive
Fluorescent
Enzyme PROBE